G-Quadruplex Formation by DNA Sequences Deficient in Guanines: Two Tetrad Parallel Quadruplexes Do Not Fold Intramolecularly

Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.     

Conception and Evaluation of a Library of Cleavable Mass Tags for Digital Polymers Sequencing

A library of phosphoramidite monomers containing a main-chain cleavable alkoxyamine and a side-chain substituent of variable molar mass (i.e. mass tag) was prepared in this work. These monomers can be used in automated solid-phase phosphoramidite chemistry and therefore incorporated periodically as spacers inside digitally-encoded poly(phosphodiester) chains. Consequently, the formed polymers contain tagged cleavable sites that guide their fragmentation in mass spectrometry sequencing and enhance their digital readability. The spacers were all prepared via a seven steps synthetic procedure. They were afterwards tested for the synthesis and sequencing of model digital polymers. Uniform digitally-encoded polymers were obtained as major species in all cases, even though some minor defects were sometimes detected. Furthermore, the polymers were decoded in pseudo-MS³ conditions, thus confirming the reliability and versatility of the spacers library.     

Influence of the Crystallinity of Silver Nanoparticles on Their Magnetic Properties

The magnetic properties of noble-metal nanoparticles are a puzzling phenomenon, tentatively often explained as a size effect or a ligand effect. Many experimental studies performed to date have attempted to vary these readily available parameters without reaching a definitive conclusion. In an attempt at better understanding the role of core crystallinity on these magnetic properties, we have compared the behavior of silver nanoparticles, which were either single-crystalline or multi-twinned, of almost identical sizes and with the same ligand coating. Our results indicate that single-crystalline nanoparticles tend to behave as classical paramagnetic materials, whereas multi-twinned ones exhibit a combination of para- and ferro-magnetic behaviors. Our hypothesis is that lattice defects within the core bear magnetic moments which couple through conduction electrons, with dipolar interactions also playing a local and macroscopic role.     

Mechanochemical Desymmetrization of Unbiased Bis- and Tris-alkynes to Access 3,5-Isoxazoles-Alkyne Adducts and Unsymmetrical Bis-3,5-isoxazoles**

A mechanochemical desymmetrization of symmetrical bis- and tris-alkynes by a controlled 1,3-dipolar cycloaddition reaction using nitrile oxide dipoles (NOs). This operationally simple protocol allows access to 3,5-isoxazole-alkyne adducts from easily prepared or commercially available symmetrical bis- and tris-alkynes in moderate to excellent yields. In addition, we have highlighted the synthetic utility of 3,5-isoxazole-alkyne by developing a route to access, for the first time, β-ketoenamine-alkyne derivatives, and unsymmetrical bis-3,5-isoxazoles.     

Aggregation phenomena in polyelectrolyte multilayers made from polyelectrolytes bearing bulky functional,hydrophobic fragments

The functionalization of polyelectrolyte multilayers often implies the use of bulky functional fragments, attached to a standard polyelectrolyte matrix. Despite of the high density of non-charged, often hydrophobic substituents, regular film growth by sequential adsorption proceeds easily when an appropriate polyelectrolyte counter ion is chosen. However, the functional fragments may cluster or aggregate. This complication is particularly evident when using chromophores and fluorophores as bulky pendant groups. Attention has to be paid to this phenomenon for the design of functional polyelectrolyte films, as aggregation may modify crucially the properties. The use of charged spacer groups does not necessarily suppress the aggregation of functional side groups. Still, clustering and aggregation depend on the detailed system employed, and are not obligatory. In the case of cationic poly(acrylamide)s labeled with naphthalene and pyrene fluorophores, for instance, the polymers form intramolecular hydrophobic associates in solution, as indicated by strong excimer formation. But the polymers can undergo a conformational rearrangement upon adsorption so that they are decoiled in the adsorbed films. Analogous observations are made for polyanions bearing mesogenic biphenyls fragments. In contrast, polycations functionalized with the dye coumarin 343 show little aggregation in solution, but a marked aggregation in the ESA films.