Continuous monitoring of thermooxidative degradation products of polystyrene by membrane extraction with sorbent interface and gas chromatography

A novel method for the continuous monitoring of thermooxidative degradation products of polystyrene by membrane extraction with sorbent interface (MESI) and gas chromatography (GC) is developed. The results are compared with solid-phase microextraction-GC, which can extract gases, vapors, and aerosols. The volatile and semivolatile degradation products are identified by mass spectrometry. The membrane used in the MESI-GC analysis shows a high permeation for volatile aromatic hydrocarbons; a low permeation for corresponding volatile aldehydes; and no permeation for less volatile alcohols, acids, and degradation products with a high molecular weight, thus reducing significantly the number of compounds detected from MESI-GC. Sensitivity of the method depends on the time of trapping, which is limited by the breakthrough of the trap. By heating the trap at fixed intervals of time, consecutive gas chromatograms are obtained.     

Synthesis of Functionalized (2-Thienylcarbonyl)thiazoles and 4-(2-Thienyl)pyridines by Reaction of (2-Thienylcarbonyl)thioacetanilides and their Enamine Derivatives

Summary. The condensation of two molecules of 2-(2-thienylcarbonyl)thioacetanilides catalyzed by piperidine yielded thiazole derivatives as confirmed by X-ray crystal structure analysis. The reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid thioanilides furnished 6-amino-1-aryl-4-(2-thienyl)-1,2-dihydro-2-thioxopyridine-5-carbonitriles. A similar reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid anilides provided 2-oxopyridine-5-carbonitriles.     

Adsorption of<Emphasis Type="Italic"> N</Emphasis>-dodecyl-<Emphasis Type="Italic">N</Emphasis>,<Emphasis Type="Italic">N</Emphasis>-dimethyl-3-ammonio-1-propanesulfonate (DDAPS), a model zwitterionic surfactant,on the Au(111) electrode surface

Electrochemical measurements including cyclic voltammetry, differential capacity, and chronocoulometry have been used to characterize the adsorption behaviors of the zwitterionic surfactant N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate (DDAPS) on the Au(111) electrode surface. The thermodynamics of the ideally polarized electrode have been employed to determine the Gibbs excess and the Gibbs energy of adsorption. The results show that the adsorption of DDAPS has a multistate character. The first two states are observed at potentials close to zero charge. At low bulk DDAPS concentrations, it corresponds to the formation of a film of nearly flat adsorbed molecules. At higher concentrations it is converted into a hemimicellar state. The second state is formed at negative potentials and charge densities close to 0 C cm^–2. It corresponds to a film of tilted molecules oriented with the hydrocarbon tail towards the metal and the polar head toward the solution.Dedicated to Professor Zbigniew Galus on the occasion of his 70^th birthday and in recognition of his many contributions to electrochemistry.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Intra- and intermolecular fluorescence quenching in 7-(pyridyl)indoles

Three isomeric 7-(pyridyl)indoles reveal very different, solvent-dependent photophysical properties. Due to rapid excited state depopulation involving intramolecular hydrogen bonding, 7-(2′-pyridyl)indole is practically nonfluorescent at room temperature. In nonpolar and polar aprotic solvents, 7-(3′-pyridyl)indole and 7-(4′-pyridyl)indole fluorescence strongly, but the emission is quenched in alcohols. Syn and anti rotameric forms of 7-(3′-pyridyl)indole are detected, each quenched to a different degree. This differential quenching is interpreted as evidence of enhanced S₁ → S₀ internal conversion being more efficient in cyclic solvates, with alcohol molecules forming a bridge between the proton donor and acceptor groups of an excited chromophore.     

Temperature coefficient of NH chemical shifts of thioamides and amides in relation to structure

NH chemical shift temperature coefficients have been measured in a large series of N-substituted-3-piperidinethiopropionamides in which the NN distances are short but of varied length, as well as in a couple of the corresponding amides and in some simpler amides and thioamides. Geometries are calculated by means of ab initio DFT methods. The N-substituted-3-piperidinethiopropionamides show in most cases strong intramolecular N–HN hydrogen bonds according to IR spectra and ab initio calculations. For compounds with rather short NN distances the S=C–N–H moiety is non-planar. Dihedral angles as small as 160° are found. The NH chemical shift coefficients measured in non-polar solvents in all the N-substituted-3-piperidinethiopropionamides are more negative (−8 to −17 ppb/K) than in non-hydrogen bonded thioamides. For the latter in non-polar solvents like CDCl₃ and toluene the temperature coefficients are as small as −1 to −4 ppb/K. The large negative effects can be related not only to the non-planarity of the thioamide group in a way that the more pronounced the non-planarity the more negative the temperature coefficients, but also to strong hydrogen bonding and the fact that the acceptor is a nitrogen. For similar amides with non-planar amide groups and nitrogen acceptor large negative temperature coefficients are likewise seen. In polar solvents like DMF the effects in simple thioamides are uniform and close to −6 ppb/K, whereas in the more complex compound like 4p(t) the temperature coefficient is close to 0. An essential feature of measuring temperature coefficients of compounds without strong intramolecular hydrogen bonds in non-polar solvents and at low temperatures is to keep the concentration low enough to avoid dimerisation.     

Raman spectroscopy and imaging: applications in human breast cancer diagnosis

The applications of spectroscopic methods in cancer detection open new possibilities in early stage diagnostics. Raman spectroscopy and Raman imaging represent novel and rapidly developing tools in cancer diagnosis. In the study described in this paper Raman spectroscopy has been employed to examine noncancerous and cancerous human breast tissues of the same patient. The most significant differences between noncancerous and cancerous tissues were found in regions characteristic for the vibrations of carotenoids, lipids and proteins. Particular attention was paid to the role played by unsaturated fatty acids in the differentiation between the noncancerous and the cancerous tissues. Comparison of Raman spectra of the noncancerous and the cancerous tissues with the spectra of oleic, linoleic, α-linolenic, γ-linolenic, docosahexaenoic and eicosapentaenoic acids has been presented. The role of sample preparation in the determination of cancer markers is also discussed in this study.     

Ab initio calculations of relativistic and electron correlation effects in polyatomics using the universal Gaussian basis set: XeF2

Ab initio accurate all-electron relativistic molecular orbital Dirac–Fock self-consistent field calculations are reported for the linear symmetric XeF₂ molecule at various internuclear distances with our recently developed relativistic universal Gaussian basis set. The nonrelativistic limit Hartree–Fock calculations were also performed for XeF₂ at various internuclear distances. The relativistic correction to the electronic energy of XeF₂ was calculated as ～ ?215 hartrees (?5850 eV) by using the Dirac–Fock method. The dominant magnetic part of the Breit interaction correction to the nonrelativistic interelectron Coulomb repulsion was included in our calculations by both the Dirac–Fock–Breit self-consistent field and perturbation methods. The calculated Breit correction is ～6.5 hartrees (177 eV) for XeF₂. The relativistic Dirac–Fock as well as the nonrelativistic HF wave functions predict XeF₂ to be unbound, due to neglect of electron correlation effects. These effects were incorporated for XeF₂ by using various ab initio post Hartree–Fock methods. The calculated dissociation energy obtained using the MP 2(full) method with our extensive basis set of 313 primitive Gaussians that included d and f polarization functions on Xe and F is 2.77 eV, whereas the experimental dissociation energy is 2.78 eV. The calculated correlation energy is ～ ?2 hartrees (?54 eV) at the predicted internuclear distance of 1.986 Å, which is in excellent agreement with the experimental Xe—F distance of 1.979 Å in XeF₂. In summary, electron correlation effects must be included in accurate ab initio calculations since it has been shown here that their inclusion is crucial for obtaining theoretical dissociation energy (D_e) close to experimental value for XeF₂. Furthermore, relativistic effects have been shown to make an extremely significant contribution to the total energy and orbital binding energies of XeF₂. © 1995 John Wiley & Sons, Inc.     

The 2‐Cyano‐2,2‐dimethylethanimine‐N‐oxymethyl Group for the 2′‐Hydroxyl Protection of Ribonucleosides in the Solid‐Phase Synthesis of RNA Sequences

The reaction of 2‐cyano‐2‐methyl propanal with 2′‐O‐aminooxymethylribonucleosides leads to stable and yet reversible 2′‐O‐(2‐cyano‐2,2‐dimethylethanimine‐N‐oxymethyl)ribonucleosides. Following N‐protection of the nucleobases, 5′‐dimethoxytritylation and 3′‐phosphitylation, the resulting 2′‐protected ribonucleoside phosphoramidite monomers are employed in the solid‐phase synthesis of three chimeric RNA sequences, each differing in their ratios of purine/pyrimidine. When the activation of phosphoramidite monomers is performed in the presence of 5‐benzylthio‐1H‐tetrazole, coupling efficiencies averaging 99 % are obtained within 180 s. Upon completion of the RNA‐chain assemblies, removal of the nucleobase and phosphate protecting groups and release of the sequences from the solid support are carried out under standard basic conditions, whereas the cleavage of 2′‐O‐(2‐cyano‐2,2‐dimethylethanimine‐N‐oxymethyl) protective groups is effected (without releasing RNA alkylating side‐products) by treatment with tetra‐n‐butylammonium fluoride (0.5 m) in dry DMSO over a period of 24–48 h at 55 °C. Characterization of the fully deprotected RNA sequences by polyacrylamide gel electrophoresis (PAGE), enzymatic hydrolysis, and matrix‐assisted laser desorption/ionization (MALDI) mass spectrometry confirmed the identity and quality of these sequences. Thus, the use of 2′‐O‐aminooxymethylribonucleosides in the design of new 2′‐hydroxyl protecting groups is a powerful approach to the development of a straightforward, efficient, and cost‐effective method for the chemical synthesis of high‐quality RNA sequences in the framework of RNA interference applications.     

Stereospecific Synthesis of (2E,13Z)‐2,13‐Octadecadienyl Acetate,the Sex Pheromone Component of the Lepidoptera Species

The main component of the sex pheromone of many lepidopteran pests, (2E,13Z)‐2,13‐octadecadienyl acetate (1), has been synthesized following a simple route using 12‐(2‐tetrahydropyranyloxy)‐1‐dodecyne (2) as the starting material.