Excited-state proton transfer in N-methyl-6-hydroxyquinolinium salts: solvent and temperature effects

The excited-state proton transfer (ESPT) reaction of the "super"photoacid N-methyl-6-hydroxyquinolinium (MHQ) was studied using both fluorescence upconversion and time-correlated single photon counting (TCSPC) techniques. The ultrafast ESPT kinetics were investigated in various alcohols and water and determined to be solvent-controlled. The ESPT temperature dependence of MHQ was also studied in various alcohols and compared to that observed for another "super"photoacid, 5,8-dicyano-2-naphthol (DCN2). A full set of kinetic and thermodynamic parameters describing the ESPT was obtained. The protolytic photodissociation rate constant for MHQ was higher than that for DCN2, while the ESPT activation energies of MHQ were smaller. These findings are attributed to the approximately 3 orders of magnitude differences in excited-state acidities of MHQ and DCN2.     

Determination of the plasticizer N-butylbenzenesulfonamide and the pharmaceutical Ibuprofen in wastewater using solid phase microextraction (SPME)

A rapid, inexpensive and solvent-free method for the simultaneous determination of the polyamide plasticizer N-butylbenzenesulfonamide (NBBS) and the widely used pharmaceutical Ibuprofen by solid phase microextraction (SPME) combined with gas chromatography/mass spectrometry (GC/MSD) in wastewater samples was developed. Besides the optimized analytical conditions, results of investigations with varying analytical parameters are reported. Problems, which may occur during the analytical procedure (e.g. salt deposits, adsorption phenomena, carry-over), are discussed. For the determination of Ibuprofen, it is important to carry out the extraction under acidic conditions with sufficiently buffered samples; the GC/MSD system must be very clean and well maintained. SPME allows an extraction of Ibuprofen without derivatization of its carboxylic group. For quantification in complex matrices, the standard addition technique is necessary. Limit of detection and limit of determination are 0.1 μg/L for both analytes. NBBS and Ibuprofen were detected in several raw and treated wastewater samples from municipal wastewater treatment plants in the range from < 0.1 to 3.5 μg/L. Received: 13 March 1998 / Revised: 16 June 1998 / Accepted: 19 June 1998     

Putative DNA quadruplex formation within the human c-kit oncogene

The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.     

Effect of temperature on excited-state proton tunneling in wt-green fluorescent protein

Steady-state emission and time-correlated single-photon counting (TCSPC) are used to measure the temperature dependence of the proton-transfer rate of wt-GFP in H2O and D2O. As the temperature decreases, the proton-transfer rate from the protonated form slows down. At about 80 K, the rate is about 10-fold slower than the rate at room temperature. At lower temperatures of 70 K down to 13 K (the lowest temperature studied), the rate of proton transfer is almost temperature independent. We explain the temperature dependence of the proton-transfer rate by an intermolecular vibration assisted tunneling mechanism. We attribute the specific intermolecular vibration to the oscillation of two oxygen atoms: the chromophore's phenol ring and the nearby water molecule. The kinetic isotope effect is about 5 and is almost temperature independent.     

Origin of the nonexponential dynamics of excited-state proton transfer in wt-green fluorescent protein

We used an inhomogeneous excited-state proton-transfer kinetics model to explain the origin of the non-exponential time-resolved emission of the A-band of wt-green fluorescence protein. The calculated fit is rather good for both H 2O and D 2O samples in a wide temperature range of 80-229 K. We attribute the inhomogeneous kinetics to the distance dependence of the excited-state proton-transfer rate between the proton donor (the hydroxyl group of the chromophore) and the oxygen of a nearby water molecule.     

Four-stranded nucleic acids: structure, function and targeting of G-quadruplexes

There are many structures that can be adopted by nucleic acids other than the famous Watson-Crick duplex form. This tutorial review describes the guanine rich G-quadruplex structure, highlighting the chemical interactions governing its formation, and the topological variants that exist. The methods that are used to study G-quadruplex structures are described, with examples of the information that may be derived from these different methods. Next, the proposed biological functions of G-quadruplexes are discussed, highlighting especially their presence in telomeric regions and gene promoters. G-quadruplex structures are the subject of considerable interest for the development of small-molecule ligands, and are also the targets of a wide variety of natural proteins.     

Ultrafast proton transfer of three novel quinone cyanine photoacids

Steady-state and time-resolved emission techniques were used to study the photoprotolytic properties of three recently synthesized strong quinone cyanine photoacids (QCy7 and its sulfonated derivatives). The rate coefficient of the excited-state proton transfer (ESPT), k(PT), of the three dyes is roughly 1.5 × 10(12) s(-1), a high value that is comparable to the solvation dynamics rate of large polar organic molecules in H(2)O and D(2)O. It is twice as fast as the proton transfer rate between two adjacent water molecules in liquid water. We found that, as expected, two of the sulfonated photoacids geminately recombines with the proton at an elevated rate. The accelerated geminate recombination process of the sulfonated derivatives is different from a simple diffusion process of protons. The ESPT rate coefficient of these molecules is the highest recorded thus far.     

Proton antenna effect of the gamma-cyclodextrin outer surface, measured by excited state proton transfer

The reversible proton dissociation and geminate recombination of the common photoacid, 8-hydroxypyrene-1,3,6-trisulfonate (pyranine), either in dilute aqueous solution or when forming a complex with gamma-cyclodextrin (gamma-CD), has been studied by time-resolved fluorescence spectroscopy and supplemented by molecular modeling and dynamics simulations. We find that the dissociation rate of the proton from the excited molecule was decreased to about approximately 50% of its value in water, while the rate of recombination was doubled. These observations were evaluated by molecular modeling of the reactants at atomic resolution. The combination of the two methodologies indicates that the pyranine in the complex can assume more than one level of interaction with the solvent. The polysugar torus surrounding the pyranine perturbs the hydrogen bond in the dye's immediate vicinity and deforms the electrostatic potential inside the Coulomb cage, causing major deviations from a simple spheric symmetry. These observations can account for the special kinetic features measured for the complex. We suggest that this system can be used as a basic model for evaluating the mechanism of proton transfer in non-homogeneous systems, such as the surface of proteins or biomembranes.