Rough set approach to multiple criteria classification with imprecise evaluations and assignments

Dominance-based Rough Set Approach (DRSA) has been introduced to deal with multiple criteria classification (also called multiple criteria sorting, or ordinal classification with monotonicity constraints), where assignments of objects may be inconsistent with respect to dominance principle. In this paper, we consider an extension of DRSA to the context of imprecise evaluations of objects on condition criteria and imprecise assignments of objects to decision classes. The imprecisions are given in the form of intervals of possible values. In order to solve the problem, we reformulate the dominance principle and introduce second-order rough approximations. The presented methodology preserves well-known properties of rough approximations, such as rough inclusion, complementarity, identity of boundaries and precisiation. Moreover, the meaning of the precisiation property is extended to the considered case. The paper presents also a way to reduce decision tables and to induce decision rules from rough approximations.     

Proton reduction and dihydrogen oxidation on models of the [2Fe]H cluster of [Fe] hydrogenases. A density functional theory investigation

Density functional theory was used to compare reaction pathways for H2 formation and H+ reduction catalyzed by models of the binuclear cluster found in the active site of [Fe] hydrogenases. Terminal H+ binding to an Fe(I)-Fe(I) form, followed by monoelectron reduction and protonation of the di(thiomethyl)amine ligand, can conveniently lead to H2 formation and release, suggesting that this mechanism could be operative within the enzyme active site. However, a pathway that implies the initial formation of Fe(II)-Fe(II) mu-H species and release of H2 from an Fe(II)-Fe(I) form is characterized by only slightly less favored energy profiles. In both cases, H2 formation becomes less favored when taking into account the competition between CN and amine groups for H+ binding, an observation that can be relevant for the design of novel synthetic catalysts. H2 cleavage can take place on Fe(II)-Fe(II) redox species, in agreement with previous proposals [Fan, H.-J.; Hall, M. B. J. Am. Chem. Soc. 2001, 123, 3828] and, in complexes characterized by terminal CO groups, does not need the involvement of an external base. The step in H2 oxidation characterized by larger energy barriers corresponds to the second H+ extraction from the cluster, both considering Fe(II)-Fe(II) and Fe(II)-Fe(III) species. A comparison of the different reaction pathways reveals that H2 formation could involve only Fe(I)-Fe(I), Fe(II)-Fe(I), and Fe(II)-Fe(II) species, whereas Fe(III)-Fe(II) species might be relevant in H2 cleavage.     

Charmed hadrons from coalescence plus fragmentation in relativistic nucleus-nucleus collisions at RHIC and LHC

In a coalescence plus fragmentation approach we calculate the heavy baryon/meson ratio and the \(p_T\) spectra of charmed hadrons \(D^{0}\), \(D_{s}\) and \(\varLambda _{c}^{+}\) in a wide range of transverse momentum from low \(p_T\) up to about 10 GeV and discuss their ratios from RHIC to LHC energies without any change of the coalescence parameters. We have included the contribution from decays of heavy hadron resonances and also the one due to fragmentation of heavy quarks which do not undergo the coalescence process. The coalescence process is tuned to have all charm quarks hadronizing in the \(p_T\rightarrow 0\) limit and at finite \(p_T\) charm quarks not undergoing coalescence are hadronized by independent fragmentation. The \(p_T\) dependence of the baryon/meson ratios are found to be sensitive to the masses of coalescing quarks, in particular the \(\varLambda _{c}/D^{0}\) can reach values of about \(\mathrm 1\div 1.5 \) at \(p_T \approx \, 3\) GeV, or larger, similarly to the light baryon/meson ratio like \(p/\pi \) and \(\varLambda /K\), however a marked difference is a quite weak \(p_T\) dependence with respect to the light case, such that a larger value at intermediate \(p_T\) implies a relatively large value also for the integrated yields. A comparison with other coalescence model and with the prediction of thermal model is discussed.     

QCD factorization for forward hadron scattering at high energies

We calculate the branching ratios and CP asymmetries of the B???Ц?, ?Ц? decays in the perturbative QCD factorization approach up to the next-to-leading-order contributions. We find that the next-to-leading-order contributions can interfere with the leading-order part constructively or destructively for different decay modes. Our numerical results have a much better agreement with current available data than previous leading-order calculations, e.g., the next-to-leading-order corrections enhance the B ⁰???? ⁰ ?? ⁰ branching ratios by a factor 2.5, which is helpful to narrow the gaps between theoretic predictions and experimental data. We also update the direct CP-violation parameters, the mixing-induced CP-violation parameters of these modes, which show a better agreement with experimental data than many of the other approaches.     

Spatial harmonics modelling of planar periodic segmented waveguides

A theoretical approach based on Bloch theorem and spatial harmonics has been used to investigate the propagation characteristics in planar periodic segmented waveguides. This analytical method allows to evaluate the field distribution, the effective index and the propagation losses of these structures, taking into account both the propagating and the counterpropagating field components, thus evidencing all the phenomena which can take place in: Bragg reflections, leaky waves, etc. Results for TE fields are presented and compared with those obtained using a paraxial 2D FD-BPM method and a Padé based one, showing that no more than (1, 1) order approximants are needed to provide good estimates of the device characteristics.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Rational Design of Fe2(μ-PR2)2(L)6 Coordination Compounds Featuring Tailored Potential Inversion

It was recently discovered that some redox proteins can thermodynamically and spatially split two incoming electrons towards different pathways, resulting in the one-electron reduction of two different substrates, featuring reduction potential respectively higher and lower than the parent reductant. This energy conversion process, referred to as electron bifurcation, is relevant not only from a biochemical perspective, but also for the ground-breaking applications that electron-bifurcating molecular devices could have in the field of energy conversion. Natural electron-bifurcating systems contain a two-electron redox centre featuring potential inversion (PI), i. e. with second reduction easier than the first. With the aim of revealing key factors to tailor the span between first and second redox potentials, we performed a systematic density functional study of a 26-molecule set of models with the general formula Fe₂(μ-PR₂)₂(L)₆. It turned out that specific features such as i) a Fe−Fe antibonding character of the LUMO, ii) presence of electron-donor groups and iii) low steric congestion in the Fe's coordination sphere, are key ingredients for PI. In particular, the synergic effects of i)-iii) can lead to a span between first and second redox potentials larger than 700 mV. More generally, the “molecular recipes” herein described are expected to inspire the synthesis of Fe₂P₂ systems with tailored PI, of primary relevance to the design of electron-bifurcating molecular devices.     

Temperature-Dependent Surface Enrichment Effects in Binary Mixtures of Fluorinated and Non-Fluorinated Ionic Liquids

Using angle-resolved X-ray photoelectron spectroscopy (ARXPS), we investigate the topmost nanometers of various binary ionic liquid (IL) mixtures at different temperatures in the liquid state. The mixtures consist of ILs with the same [PF₆]⁻ anion but two different cations, namely 3-methyl-1-(3,3,4,4,4-pentafluorobutyl)imidazolium hexafluorophosphate, [PFBMIm][PF₆], and 1-butyl-3-methylimidazolium hexafluorophosphate, [C₄C₁Im][PF₆], with 10, 25, 50 and 75 mol % content of [PFBMIm][PF₆]. We observe a preferential enrichment of the fluorinated chain in the topmost layer, relative to the bulk composition, which is most pronounced for the lowest content of [PFBMIm][PF₆]. Upon cooling the mixtures stepwise from 95 °C until surface charging effects in XPS indicate solidification, we observe a pronounced increase in surface enrichment of the fluorinated chain with decreasing temperature in the liquid state. In contrast to the mixtures with lower [PFBMIm][PF₆] contents, cooling the 75 mol % mixture additionally shows an abrupt decrease of the fluorinated chain signal before complete solidification occurs, which is assigned to partial precipitation effects.     

Boundary point lemmas and overdetermined problems

Two elliptic boundary value problems are considered: a problem of mixed type in a cylindrical domain, and a Dirichlet problem in an annular domain. Under some overdetermined conditions on the boundary gradient, symmetry results for domain and solution are proved. The method of proof involves the classical boundary point lemma by Hopf, as well as a suitable adaptation of it that works well at certain corners.     

Experimental evidence of the exciton centre-of-mass quantization in Zn1−x Cd x Se/ZnSe multiple quantum wells

Il Nuovo Cimento D - We report the evidence of exciton-polariton centre-of-mass quantization in II–VI quantum wells consisting of ternary alloy. Absorption and photoluminescence studies on...