Low n-6/n-3 Gestation and Lactation Diets Influence Early Performance,Muscle and Adipose Polyunsaturated Fatty Acid Content and Deposition,and Relative Abundance of Proteins in Suckling Piglets

Elevated omega-6 (n-6) and omega-3 (n-3) polyunsaturated fatty acids (PUFAs) ratios in swine diets can potentially impose a higher risk of inflammatory and metabolic diseases in swine. A low ratio between the two omega PUFAs has beneficial effects on sows’ and piglets’ production performance and immunity status. At present, there are few studies on how sow nutrition directly affects the protein and fat deposition in suckling piglets. Two groups of sows were fed diets with high or low n-6/n-3 polyunsaturated ratios of 13:1 (SOY) and 4:1 (LIN), respectively, during gestation and lactation. Longissimus dorsi muscle and adipose tissue from newborn piglets, nourished only with sow’s milk, were subjected to fatty acid profiling by gas chromatography–mass spectrometry (GC-MS) and to proteomics assays based on nano-liquid chromatography coupled to high-resolution tandem mass spectrometry (nLC-HRMS). Fatty acid profiles on both muscle and adipose tissues resembled the magnitude of the differences between fatty acid across diets. Proteomic analysis revealed overabundance of 4 muscle and 11 adipose tissue proteins in SOY compared to LIN in both piglet tissues. The detected overabundance of haptoglobin, an acute-phase protein, and the stimulation of protein-coding genes and proteins related to the innate immune response and acute inflammatory response could be associated with the pro-inflammatory role of n-6 PUFAs.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Detection of stress whitening in plastics with the help of X-ray dark field imaging

The processing of thermoplastics can induce a wide range of defects such as stress whitening, cavitation and porosity, which can adversely affect the reliability of the final products. Hence, fast and effective non-destructive detection methods for such defects are highly important for quality assurance on production lines. In this paper, X-ray dark field imaging is presented as a new non-destructive testing method that allows the visualization of stress whitening or cavitation efficiently. The performance of the method is demonstrated for the case of an injection-moulded polyvinylidene fluoride part that exhibits stress whitening. Whereas the stress whitening could not be detected by conventional X-ray imaging, it was localized by an X-ray dark field image acquired within a few minutes. Once the precise location of the stress whitening was known, it was possible to verify the result by local micro X-ray computed tomography and by a micro section image.     

A simple,efficient, regioselective and one-pot preparation of N-hydroxy- and N–O-protected hydroxyindoles via cycloaddition of nitrosoarenes with alkynes. Synthetic scope,applications and novel by-products

The thermal reaction between nitrosoarenes and alkynes under alkylating conditions produces N-alkoxyindoles as the major products in moderate to good yields and excellent regioselectivity. Various electrophiles are used affording different N–O-protected hydroxyindoles in a multi-component fashion. Privileged acetylenic substrates used in reactions with substituted nitrosoarenes are arylalkynes or propiolates. Potentially bioactive compounds and other classes of highly functionalizable indole products were prepared. Reactions between o-carbomethoxy-nitrosoarenes and arylacetylenes provided tricyclic compounds containing an acylaziridine indoline skeleton.     

Synthetic Communication: Synthesis of Optically Pure Analogues of D-Arginine Methyl Ester with Antiarrhythmic Activity

The synthesis of the methyl esters of optically pure trans and cis 4-guanidinocyclohexylglycine as rigid analogues of D-arginine methyl ester are described.