Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Detection of stress whitening in plastics with the help of X-ray dark field imaging

The processing of thermoplastics can induce a wide range of defects such as stress whitening, cavitation and porosity, which can adversely affect the reliability of the final products. Hence, fast and effective non-destructive detection methods for such defects are highly important for quality assurance on production lines. In this paper, X-ray dark field imaging is presented as a new non-destructive testing method that allows the visualization of stress whitening or cavitation efficiently. The performance of the method is demonstrated for the case of an injection-moulded polyvinylidene fluoride part that exhibits stress whitening. Whereas the stress whitening could not be detected by conventional X-ray imaging, it was localized by an X-ray dark field image acquired within a few minutes. Once the precise location of the stress whitening was known, it was possible to verify the result by local micro X-ray computed tomography and by a micro section image.     

Modelling the soundscape quality of urban waterfronts by artificial neural networks

The renewal of the urban waterfronts has become a major focus of attention for politicians and decision makers in the city’s management programs. The recognition of the patterns that define the waterfronts’ identity is essential to select new strategies of intervention for the environmental recovery. In order to create adequate environments for everyday life within a sustainable development, new links between human senses, human perception and design need to be created. Within this wide approach, the landscape and the soundscape play a significant role and can become a key driving force in the implementation of the changes. New techniques have to be tested to identify the sonic and visual parameters capable to explain the specificity of a waterfront. With this purpose, an artificial neural network (ANN) was developed, and the relative importance of the input variables was evaluated. The collected database was also analysed by multiple linear regression (MLR) to compare the outcomes of both models. The urban waterfront of Naples (Italy) was chosen as case study. The results obtained show that the performance of the neural network is better than the one of the linear regression (rANN = 0.949, rMLR = 0.639). The interpretation of the relative importance method is also quite satisfactory in the ANN.     

A simple,efficient, regioselective and one-pot preparation of N-hydroxy- and N–O-protected hydroxyindoles via cycloaddition of nitrosoarenes with alkynes. Synthetic scope,applications and novel by-products

The thermal reaction between nitrosoarenes and alkynes under alkylating conditions produces N-alkoxyindoles as the major products in moderate to good yields and excellent regioselectivity. Various electrophiles are used affording different N–O-protected hydroxyindoles in a multi-component fashion. Privileged acetylenic substrates used in reactions with substituted nitrosoarenes are arylalkynes or propiolates. Potentially bioactive compounds and other classes of highly functionalizable indole products were prepared. Reactions between o-carbomethoxy-nitrosoarenes and arylacetylenes provided tricyclic compounds containing an acylaziridine indoline skeleton.