A molecular mechanics approach for analyzing tensile nonlinear deformation behavior of single-walled carbon nanotubes

In this paper, by capturing the atomic information and reflecting the behaviour governed by the nonlinear potential function, an analytical molecular mechanics approach is proposed. A constitutive relation for single-walled carbon nanotubes (SWCNT’s) is established to describe the nonlinear stress-strain curve of SWCNT’s and to predict both the elastic properties and breaking strain of SWCNT’s during tensile deformation. An analysis based on the virtual internal bond (VIB) model proposed by P. Zhang et al. is also presented for comparison. The results indicate that the proposed molecular mechanics approach is indeed an acceptable analytical method for analyzing the mechanical behavior of SWCNT’s. The project supported by the National Natural Science Foundation of China (10121202, 90305015 and 10328203), the Key Grant Project of Chinese Ministry of Education (0306) and the Research Grants Council of the Hong Kong Special Administrative Region, China (HKU 7195/04E).     

Which Extraction Solvents and Methods Are More Effective in Terms of Chemical Composition and Biological Activity of Alcea fasciculiflora from Turkey?

The bioactive content, antioxidant properties, and enzyme inhibition properties of extracts of Alcea fasciculiflora from Turkey prepared with different solvents (water, methanol, ethyl acetate) and extraction methods (maceration, soxhlet, homogenizer assisted extraction, and ultrasound assisted extraction) were examined in this study. UHPLC-HRMS analysis detected or annotated a total of 50 compounds in A. fasciculiflora extracts, including 18 hydroxybenzoic and hydroxycinnamic acids, 7 Hexaric acids, 7 Coumarins, 15 Flavonoids, and 3 hydroxycinnamic acid amides. The extracts had phenolic and flavonoid levels ranging from 14.25 to 24.87 mg GAE/g and 1.68 to 25.26 mg RE/g, respectively, in the analysis. Both DPPH and ABTS tests revealed radical scavenging capabilities (between 2.63 and 35.33 mg TE/g and between 13.46 and 76.27 mg TE/g, respectively). The extracts had reducing properties (CUPRAC: 40.38–78 TE/g and FRAP: 17.51–42.58 TE/g). The extracts showed metal chelating activity (18.28–46.71 mg EDTAE/g) as well as total antioxidant capacity (phosphomolybdenum test) (0.90–2.12 mmol TE/g). DPPH, ABTS, FRAP, and metal chelating tests indicated the water extracts to be the best antioxidants, while the ethyl acetate extracts had the highest overall antioxidant capacity regardless of the extraction technique. Furthermore, anti-acetylcholinesterase activity was identified in all extracts (0.17–2.80 mg GALAE/g). The water extracts and the ultrasound-assisted ethyl acetate extract were inert against butyrylcholinesterase, but the other extracts showed anti-butyrylcholinesterase activity (1.17–5.80 mg GALAE/g). Tyrosine inhibitory action was identified in all extracts (1.79–58.93 mg KAE/g), with the most effective methanolic extracts. Only the ethyl acetate and methanolic extracts produced by maceration and homogenizer aided extraction showed glucosidase inhibition (0.11–1.11 mmol ACAE/g). These findings showed the overall bioactivity of the different extracts of A. fasciculiflora and provided an overview of the combination of solvent type and extraction method that could yield bioactive profile and pharmacological properties of interest and hence, could be a useful reference for future studies on this species.     

Identification of Human Dihydroorotate Dehydrogenase Inhibitor by a Pharmacophore-Based Virtual Screening Study

Human dihydroorotate dehydrogenase (hDHODH) is an enzyme belonging to a flavin mononucleotide (FMN)-dependent family involved in de novo pyrimidine biosynthesis, a key biological pathway for highly proliferating cancer cells and pathogens. In fact, hDHODH proved to be a promising therapeutic target for the treatment of acute myelogenous leukemia, multiple myeloma, and viral and bacterial infections; therefore, the identification of novel hDHODH ligands represents a hot topic in medicinal chemistry. In this work, we reported a virtual screening study for the identification of new promising hDHODH inhibitors. A pharmacophore-based approach combined with a consensus docking analysis and molecular dynamics simulations was applied to screen a large database of commercial compounds. The whole virtual screening protocol allowed for the identification of a novel compound that is endowed with promising inhibitory activity against hDHODH and is structurally different from known ligands. These results validated the reliability of the in silico workflow and provided a valuable starting point for hit-to-lead and future lead optimization studies aimed at the development of new potent hDHODH inhibitors.     

Preparation of nano-hydroxyapatite/poly(<Emphasis Type="SmallCaps">l</Emphasis>-lactide) biocomposite microspheres

Nano-hydroxyapatite (HA)/poly(l-lactide) (PLLA) composite microspheres with relatively uniform size distribution were prepared by a solid-in-oil-in-water (s/o/w) emusion solvent evaporation method. The encapsulation of the HA nanopaticles in microshperes was significantly improved by grafting PLLA on the surface of the HA nanoparticles (p-HA) during emulsion process. This procedure gave a possibility to obtain p-HA/PLLA composite microspheres with uniform morphology and the encapsulated p-HA nanoparticle loading reached up to 40 wt% (33 wt% of pure HA) in the p-HA/PLLA composite microspheres. The microstructure of composite microspheres from core-shell to single phase changed with the variation of p-HA to PLLA ratios. p-HA/PLLA composite microspheres with the diameter range of 2–3 μm were obtained. The entrapment efficiency of p-HA in microspheres could high up to 90 wt% and that of HA was only 13 wt%. Surface and bulk characterizations of the composite microspheres were performed by measurements such as wide angle X-ray diffraction (WAXD), thermal gravimetric analysis (TGA), environmental scanning electron microscope (ESEM) and transmission electron microscopy (TEM).     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Ambivalent role of metal chlorides in ring opening reactions of 2H-azirines: synthesis of imidazoles,pyrroles and pyrrolinones

2H-Azirines were found to react with imines, enaminones and enaminoesters in the presence of metal salts. Imidazoles, pyrroles and new pyrrolinones derivatives are isolated in good overall yields. The role of metal salts was investigated as they can act as Lewis acids or electron donors. Mechanisms are proposed suggesting that imidazoles arise from addition of azirine to imines via radical or ionic mechanism; pyrroles and pyrrolinones are obtained from azirines with enamino derivatives when the salt acts as a Lewis acid. In the latter case the properties of the metallic compound influence the reaction regioselectivity.     

The effect of drying method on the properties and nanoscale structure of cellulose whiskers

Cellulose whiskers were prepared from wood- and cotton-based microcrystalline cellulose and dried by two methods: freeze-drying or air-drying. The effect of drying method on the properties and structure of the whiskers were studied. Furthermore, the influence of the source of cellulose on the nanoscale structure was investigated. Drying method was observed to slightly influence the thermal stability of cellulose whiskers, whereas the char residue varied significantly depending on the drying process performed. Small- and wide-angle X-ray scattering and solid state nuclear magnetic resonance spectroscopy were used to examine the crystallinity and nanoscale structure of the dried whiskers. It was observed that the crystal structure and crystallinity of cellulose whiskers remained during all treatments, whereas their nanoscale structure was significantly influenced by drying method, neutralization, and source of cellulose. Relationships between thermal behavior and nanoscale structure were reported and discussed.     

DSC study of stabilizing effect of antioxidant mixtures in styrene-butadiene rubber

The type of cooperation between antioxidants in the binary mixtures of four substituted diphenylamines and phenotiazine in the stabilization of styrene-butadiene rubber has been tested. Thermooxidation of the samples has been studied by differential scanning calorimetry under non-isothermal conditions. The protection factors of the individual stabilizers and their mixtures were determined. The synergy factors were applied to asses the type of cooperation of antioxidants in the mixtures. From their values it can be concluded that the type of cooperation depends on temperature. The highest synergistic effect has been observed for the mixture of phenotiazine and [4-(1-methyl-1-phenyl-ethyl)-phenyl]-phenylamine.     

Numerical simulation for the temperature changing rule of the crude oil in a storage tank based on the wavelet finite element method

In order to study the temperature changing rule of the crude oil in the storage tank, the wavelet finite element method, the traditional finite element method and the test were used to carry out the numerical simulation. Firstly, the thermal wavelet finite element was put forward established based on thermal finite element theory and the wavelet theory. And the computational model and three boundary conditions were established. And then the temperature changing rule of the crude oil in the storage tank in 24 h for three boundary conditions was obtained by using three methods, and the results showed that the wavelet finite element method had advantages in the numerical analysis of the temperature changing rule of the crude oil in the storage. And then the temperature distribution rule of the crude oil in the storage tank under different conditions in 5 h was obtained. And the temperature changing mechanism of the crude oil was summarized finally.