Separation of capsular polysaccharide K4 and defructosylated K4 by high-performance capillary electrophoresis

A rapid, highly sensitive and reproducible high-performance capillary electrophoresis (HPCE) method (electrokinetic chromatography with sodium dodecyl sulfate) is described for the determination of the polysaccharide from the uropathogenic Escherichia coli K4 bacteria (05:K4:H4) and its defructosylated product. The two polyanions, K4 and defructosylated K4, are separated and readily determined within 30 min on an uncoated fused-silica capillary using normal polarity at 20 kV and detection at 200 nm. A linear relationship was found for the two polysaccharides over a wide range of concentrations, from approximately 30 ng (0.5 microg/microL) to 210 ng (3.5 microg/microL). The described method was used to evaluate the defructosylation process of K4 under drastic acid conditions.     

A novel general route for the preparation of enantiopure imidazolines

A novel procedure for the preparation of enantiopure 1,4-disubstituted 2-imidazolines is reported. Enantiopure beta-amino alcohols are converted into N-hydroxyethylamides, which are reacted with excess thionyl chloride, or with thionyl chloride followed by phosphorus pentachloride to yield N-chloroethylimidoyl chlorides. These intermediates are treated with amines and anilines to produce N-chloroethylamidines, which are converted into imidazolines upon workup with aqueous hydroxide. The method is simple and efficient and has been used to prepare a wide variety of enantiopure imidazolines, in a modular fashion, from readily available amino alcohols.     

A complete family of isostructural cluster compounds with cubane-like M(3)S(4)M' cores (M = Mo,W; M' = Ni,Pd, Pt): comparative crystallography and electrochemistry

By reaction of the geometrically incomplete cubane-like clusters [(eta(5)-Cp')(3)Mo(3)S(4))][pts] and [(eta(5)-Cp')(3)W(3)S(4)][pts] (Cp' = methylcyclopentadienyl; pts = p-toluenesulfonate) with group 10 alkene complexes, three new heterobimetallic clusters with cubane-like cluster cores were isolated: [(eta(5)-Cp')(3)W(3)S(4)M'(PPh(3))][pts] ([5][pts], M' = Pd; [6][pts], M' = Pt); [(eta(5)-Cp')(3)Mo(3)S(4)Ni(AsPh(3))][pts] ([7][pts]). The compounds [5][pts]-[7][pts] are completing the extensive series of clusters [(eta(5)-Cp')(3)M(3)S(4)M'(EPh(3))][pts] (M = Mo, W; M' = Ni, Pd, Pt; E = P, As) which allows the consequences of replacing a single type of atom on structural and NMR and UV/vis spectroscopic as well as electrochemical properties to be determined. Single-crystal X-ray structure determinations of [5][pts]-[7][pts] revealed that [5][pts] was not isomorphous to the other members of the series [(eta(5)-Cp')(3)M(3)S(4)M'(EPh(3))][pts] due to distinctly different cell parameters, which in the molecular structure of [5](+) is reflected in a slightly different orientation of the PPh(3) ligand. Electrochemical measurements on the series showed that the Mo-based clusters were more difficult to oxidize than their W-based analogues. The Pd-containing clusters underwent two-electron oxidation processes, whereas the Ni- and Pt-containing clusters underwent two separated one-electron oxidation processes.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

A Matter of Philosophers and Spheres: Medieval Glosses on Artephius’s Key of Wisdom

The article examines the two Latin versions of Artephius's Clavis sapientiae (Key of Wisdom) that have been preserved in early modern collections of alchemical texts. A comparative analysis of the two versions shows that one of them has undergone a process of textual manipulation. In particular, an interpolation of short philosophical passages concerning the doctrine of prime matter has relevant interpretative implications. These additions appear to be grounded in the early thirteenth-century philosophical debate on cosmology and the first Latinate reception of Aristotle’s metaphysics.     

A Two-Step Synthesis Of S-Methyl Dinucleoside Phosphorothioates

S-methyl dinucleoside phosphorothioates are prepared from 0-2,4-dichlorophenyl S-methyl nucleoside phosphorothioates by selective removal of the transient 0-2,4-dichlorophenyl protecting group followed by condensation with appropriate nucleosides in the presence of MSNT activating reagent.     

Synthesis of an Acyloxymethyl Prodrug of the Inositol Phosphate α-Trinositol

ABSTRACT

Acyloxymethylation of an acylated silver salt of α-trinositol gives, after deprotection, membrane permeable 1D-myo-inositol 1,2,6-tris(ethoxycarbonyloxymethyl sodium phosphate). The acyl groups, 3-(4,5-methylenedioxy-2-nitrophenyl)propanoyl, are cleaved by hydrogenolysis.