Styrene copolymers as pollutant adsorbents : Safe sampling volume determination

The determination of safe sampling volumes of benzene and acetone on air samplers filled with Porapak Q, Chromosorb 101, 102 and 103 is described. Two direct methods are employed; one method is based on frontal chromatography, while the second one is a concentration method followed by thermal desorption. The results are compared to those determined by the indirect pulse chromatographic method. The safe sampling volumes determined by the direct methods were in accordance. The indirect method gives slightly different values; however, this procedure is carried out at "infinite dilution". The effect of the pollutant concentration on the safe sampling volumes was also examined. The values decrease with increasing pollutant concentration.     

Analysis and interpretation of excess molar properties of amphiphile + water systems : Part 3. Excess molar volumes of isopropoxyethanol + water and isobutoxyethanol + water

Excess molar volumes at 25°C, are reported for the systems isoPrOEtOH + water and isoBuOEtOH + water across their entire composition ranges. These data have been compared to those for their normal alkyl analogs in order to assess the effects of both - and β-chain branching.

The results are discussed in terms of the relative abilities of the amphiphiles to form structured aggregates.     

Quantum chemical calculations and mutational analysis suggest heat shock protein 90 catalyzes trans-cis isomerization of geldanamycin

The affinity of geldanamycin (GA) for binding to heat shock protein 90 (HSP90) is 50- to 100-fold weaker than is the affinity of the structurally distinct natural product radicicol. X-ray crystallography shows that although radicicol maintains its free conformation when bound to HSP90, the conformation of GA is dramatically altered from an extended conformation with a trans amide bond to a kinked shape in which the amide group in the ansa ring has the cis configuration. We have performed ab initio quantum chemical calculations to demonstrate that the trans-cis isomeriztion of GA in solution is both kinetically and thermodynamically unfavorable. Thus, we propose that HSP90 catalyzes the isomerization of GA. We identify Ser113, a conserved residue outside the ATP binding pocket, as essential for the isomerization of GA. In support of this model, we show that radicicol binds equally well to both wild-type HSP90 and the Ser113 mutant, whereas the binding of GA to the Ser113 mutant is decreased significantly from its binding to wild-type HSP90. Based on this finding, a mechanism of keto-enol tautomerization of GA catalyzed by HSP90 is proposed. The added requirement of isomerization prior to tight binding may explain the enhanced binding affinity of GA for HSP90 in a cell extract versus in a purified form.     

Studies towards the total synthesis of contignasterol

The (17R,20S,22S,24S) C₂₀-C₂₉ segment of contignasterol has been stereoselectively prepared in 8 steps and 40% overall yield from (S)-carvone. Synthetic studies towards contignasterol's C/D ring functionalization/isomerization are also reported.     

Calculated structures and relative stabilities of furoxan,some 1,2-dinitrosoethylenes and other isomers

The structures and relative stabilities of furoxan and some of its isomers, e.g., the 1,2-dinitrosoethylenes, have been determined by means of ab initio Hartee–Fock and Møller–Plesset calculations. Geometries were optimized at the HF/3-21G, HF/6-31G* and MP2/6-31G* levels, and subsequently used for computing MP2/6-31G*, MP3/6-31G*, and MP4/6-31G* energies. The results are markedly affected by the inclusion of electronic correlation, which renders three of the isomers unstable. It also emphasizes the importance of a zwitterionic contribution to the structure of furoxan, which promotes ring-opening through a cis 1,2-dinitrosoethylene intermediate/transition state that has an MP4/6-31G*//MP2/6-31G* energy that is 31.6 kcal/mol above furoxan.     

Application of relaxation periods during electrodialysis of a casein solution: Impact on anion-exchange membrane fouling

Electrodialysis (ED) is a membrane process used on a large scale. However, one of the common problems is fouling of ion-exchange membranes stacked in the cell. The use of pulsed power, consisting in applying a constant current density during a fixed time of application (T_on) followed by a pause duration (T_off), was demonstrated recently as an effective fouling mitigation method for electrodialysis. Up until now, no work has investigated the potential of electrodialysis using pulsed electric field on protein fouling. The aim of the present work was to study the influence of pulsed electric field (PEF) with a low frequency square shaped periodic signal (T_on = 10 s–T_off = 10 s, T_on = 10 s–T_off = 40 s) in comparison with dc current during electrodialysis of a casein solution at different current densities (10, 20 and 30 mA/cm²) on membrane fouling. It appeared from these results that PEF, under certain conditions of pulse, would avoid fouling on anion-exchange membranes. For 10 s–40 s pulsed electric field conditions, no fouling was observed with any density, while for 10 s–10 s PEF conditions, fouling appeared only at current density over 10 mA/cm². dc current, whatever the current density conditions, led to a fouling on the diluate side of the AEM. Furthermore, when fouling occurred, magnitude layer thickness and dry weight increased with the applied current density. The nature of the fouling was identified as 97% protein. The protein fouling would be due to the dissociation of water molecules and/or heat increase at the anion-exchange membrane interface. The relaxation time of the pulse would limit both phenomena on the membrane.     

New Chemotypes for the Inhibition of (p)ppGpp Synthesis in the Quest for New Antimicrobial Compounds

Antimicrobial resistance (AMR) poses a serious threat to our society from both the medical and economic point of view, while the antibiotic discovery pipeline has been dwindling over the last decades. Targeting non-essential bacterial pathways, such as those leading to antibiotic persistence, a bacterial bet-hedging strategy, will lead to new molecular entities displaying low selective pressure, thereby reducing the insurgence of AMR. Here, we describe a way to target (p)ppGpp (guanosine tetra- or penta-phosphate) signaling, a non-essential pathway involved in the formation of persisters, with a structure-based approach. A superfamily of enzymes called RSH (RelA/SpoT Homolog) regulates the intracellular levels of this alarmone. We virtually screened several fragment libraries against the (p)ppGpp synthetase domain of our RSH chosen model Rel_Seq, selected three main chemotypes, and measured their interaction with Rel_Seq by thermal shift assay and STD-NMR. Most of the tested fragments are selective for the synthetase domain, allowing us to select the aminobenzoic acid scaffold as a hit for lead development.     

Shear-induced particle segregation in binary mixtures:Verification of a percolation theory

Granular materials composed of different-sized grains may experience undesired segregation.Segrega-tion is detrimental for a lot of industries because it leads ...     

Analysis of Plant–Plant Interactions Reveals the Presence of Potent Antileukemic Compounds

A method to identify anticancer compounds in plants was proposed based on the hypothesis that these compounds are primarily present in plants to provide them with an ecological advantage over neighboring plants and other competitors. According to this view, identifying plants that contain compounds that inhibit or interfere with the development of other plant species may facilitate the discovery of novel anticancer agents. The method was developed and tested using Magnolia grandiflora, Gynoxys verrucosa, Picradeniopsis oppositifolia, and Hedyosmum racemosum, which are plant species known to possess compounds with cytotoxic activities. Plant extracts were screened for growth inhibitory activity, and then a thin-layer chromatography bioautography assay was conducted. This located the major antileukemic compounds 1, 2, 4, and 5 in the extracts. Once the active compounds were located, they were extracted and purified, and their structures were determined. The growth inhibitory activity of the purified compounds showed a significant correlation with their antileukemic activity. The proposed approach is rapid, inexpensive, and can easily be implemented in areas of the world with high biodiversity but with less access to advanced facilities and biological assays.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.