X-ray investigation of the role of the mixed emulsifier in the structure formation in o/w creams

The aim of this research work was to clarify the role of the mixed emulsifier in the structure formation and water binding mode in the case of o/w creams prepared with different surfactants. The swelling behavior of mixed emulsifiers was examined by means of direct investigation methods such as transmission electron microscopy (TEM) and X-ray diffraction. The detailed structure image of the creams was created with the help of the latter. The influence of the structure of the hydrophilic gel phase, and the structural changes during storage were studied with rheological methods. On the basis of the results, it can be stated that the investigated creams had different structures from those mentioned in the literature: surfactant did not create a mixed bilayer with the structure to furnish fatty amphiphile; instead, micelles were formed. These results correlated well with the results of the rheological tests.     

Origin of organic gaseous products formed in the thermal decomposition of formates

The gaseous products of the thermal decomposition of formates have been investigated and compared with the products of formaldehyde and synthesis gas transformation under analogous conditions in the presence of the solids formed in the thermal decomposition of particular formates. It was found that formaldehyde transformation leads to organic compounds identical to those obtained in the thermal decomposition of the respective formates, while synthesis gas does not react under such conditions. This fact substantiates the hypothesis that formaldehyde is a precursor of the organic compounds identified in the thermal decomposition of formates. The nature of the organic componds obtained in the thermal decomposition of formates indicates that the formaldehyde formed in the initial stages is then transformed in the Cannizzaro or Tishchenko reactions.

---

Zusammenfassung Die gasförmigen Produkte der thermischen Zersetzung von Formiaten wurden untersucht und mit den Produkten verglichen, die bei der Umwandlung von Formaldehyd und Synthesegas unter analogen Bedingungen in Gegenwart von bei der thermischen Zersetzung von speziellen Formiaten gebildeten Feststoffen entstehen. Formaldehydumwandlungen führen zu organischen Verbindungen, die identisch mit denen sind, die bei der thermischen Zersetzung des betreffenden Formiats gebildet werden, während Synthesegas unter solchen Bedingungen nicht reagiert. Dies erhärtet die Hypothese, daß Formaldehyd eine Vorstufe der bei der thermischen Zersetzung von Formiaten identifizierten organischen Verbindungen ist. Die Natur der bei der thermischen Zersetzung von Formiaten auftretenden organischen Verbindungen weist darauf hin, daß das in den ersten Reaktionsschritten gebildete Formaldehyd nach der Cannizzaro-oder Tishchenko-Reaktion weiterreagiert.

---

, , . , i , . . , , . , , , .

     

Preparation of Layer Structure-Controlled Ru-Sn-Al2O3 Catalysts and Their Reactivity

In order to achieve functional group selective hydrogenation, the layer structure of Ru-Sn-Al2O3 catalysts was controlled by using sol-gel, powder impregnation and combined sol-gel impregnation methods. The properties of the catalysts and effectiveness in hydrogenation of dimethyl terephthalate were examined. The surface Sn contents of the catalysts characterized by X-ray photoelectron spectroscopy depended on the preparation method, in spite of almost the same bulk Ru and Sn compositions measured by X-ray fluorescence analyses. TPR and CO adsorption of the catalysts also depended on the preparation method. With regard to the conversion rate of dimethyl terephthalate and the rate of product conversion from methyl 4-hydroxy methylbenzoate to p-xylene via methyl p-toluate, Ru impregnation catalysts had higher rates than the other catalysts.     

Quantum spheres

Spaces homogeneous under the action of the quantum SU(2) group are introduced and investigated. These spaces can be considered as noncommutative two-dimensional spheres of different radii. The geometry of the space built from those spheres makes possible one-particle dipole electric transitions with l=0.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Synthesis of new guanidine derivatives from 2′,3′,4′,9′-tetrahydrospiro[piperidine-4,1′-[1H]pyrido[3,4-b]indole]

The reaction of the isothiourea derivative 2 with methylaminc or pyrrolidine resulted in guanidines 3a-3b . Using hydrazine under the same conditions the tetrazole derivative 4 was obtained. On reacting 2 with piperidine, morpholine, methylhydrazine, phenylhydrazine, hydroxylamine or sodium hydroxide, cycliza-tion took place leading to the novel 4-cyanimino-1,2,3,4,6,7,12,12b-octahydro-3,12b-ethanopyrim-ido[1′,6′:1,2]pyrido[3,4-b]indole ( 5 ). Some structural aspects of 5 and other model compounds were analysed mainly by ¹³C nmr spectroscopy.     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Synthesis and properties of 1-(6-methoxy)-2-benzothiazolyl)-2-pyridones

Substituted ]-(6-methoxy-2-benzothiazolyt)-2-pyridones were prepared from 2-amino-6-methoxybenzathiazate through N-(6-methoxy-2-benzothiazotyl) cyanvorearmileaznd-3-aryl-N-(6-methoxy-2-benzothiazolyt)-2-cyano-2-propenamides. The cyclization of the latter with malonodinitrile in the presence of piperidine gave the corresponding pyridones. The structures of the synthesized compounds were confirmed by¹H NMR and mass spectral data.Department of Organic Chemistry, Mass Spectrometry Laboratory, Slovak Technical University, 812 37 Bratislava, Slovakia. Published in Khimiya Geterotsiklicheskikh Soedinenii, No. 10, pp. 1402–1404, October, 1995. Original article submitted August 24, 1995.