The ionization constants of alpha-alanine in NaCl at 25 degrees. Effect of the ionic strength based on three models

In the present work we obtained the experimental pKs of the amino acid alpha-alanine in NaCl at 25 degrees and different ionic strengths. The equilibrium constants have been potentiometrically determined with a commercial glass electrode and the results analysed through three models: two directly based on the Pitzer and Scatchard approaches to the ion specific interaction theory and the other based on a simpler modification of the Debye-Hückel equation. The three models fit the data reasonably well and the extrapolated pK values obtained show a good agreement. The goodness of the ridge regression method cannot be probed in this case.     

New aspects on the transuranics transfer in the Palomares marine environment

The environmental contamination of transuranics following the Palomares accident in 1966 (Southern Spain) has been continuous monitored on land and scientific programs are still running. The study of the land to sea transfer of the contamination started in 1986, focussed on the depositional history recorded in marine sediments. At the continental shelf, south of the mouth of the Almanzora river, enhanced levels of plutonium and americium were found which could be related to the accident. Additional analysis of marine sediments, collected far from the impact point, showed the presence of a hot particle. The study of the chronology of this sediment core and the isotopic ratios are given in this paper to assess the origin and pathway of the particle. The route of this particle was found to be the aerial transfer at the time of the accident.     

Comparison of chemical properties of food products processed by conventional and ohmic heating

The effect of ohmic and conventional heat processing of different food products on their chemical and physical parameters was studied. Depending on the food being analysed, parameters such as pH, total solids, ash, titratable acidity, ascorbic acid, total sugars, total fatty acids, total phenolic compounds, and anthocyanins content were determined before and after ohmic and conventional pasteurization techniques and the results were compared using one-way analysis of variance. In goat milk samples treated by ohmic technology the pH value (6.58) and total fatty acids content in milk fat (86.5 mass %) were comparable to those found in milk treated by conventional process, however, ohmically treated samples presented a lower content of lactic acid, 0.13 %. In cloudberry jam samples treated by ohmic technology the results of some of the main parameters tested, such as total sugar content 46.1 mass %, ascorbic acid content 2.83 mass %, and titratable acidity 6.01 mass % (as citric acid) did not show significant differences when compared with samples treated by conventional technology. Presented at the 33rd International Conference of the Slovak Society of Chemical Engineering, Tatranské Matliare, 22–26 May 2006.     

Single-step preparation and catalytic activity of mesoporous MCM-41 and SBA-15 silicas functionalized with perfluoroalkylsulfonic acid groups analogous to Nafion

Preparation of hybrid organic-inorganic MCM-41 and SBA-15 silicas functionalized with perfluoroalkylsulfonic acid groups has been achieved in a single step by reacting the mesoporous silicas with 1,2,2-trifluoro-2-hydroxy-1-trifluoromethylethane sulfonic acid beta-sultone; the catalysts showed higher activity than commercial Nafion-silica composite for the esterification of long chain fatty acids with ethanol.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Effect of ionic strength on the formal potential of the glass electrode in various saline media

We examined the variation with ionic strength (I, adjusted with KCl, KNO₃, KBr, NaCl or NaClO₄) of the formal potential (E_const) for glass electrodes exhibiting a Nernstian response (i.e. E_cell=E_const−s log [H⁺]). For this purpose, we investigated the different factors included in the formal potential, so we obtained reported values for the liquid junction potential as a function of ionic strength and determined the logarithm of the activity coefficient for the proton in various saline media, using Pitzer equations.     

Supramolecular helical mesomorphic polymers. Chiral induction through H-bonding

The work described here concerns a challenge of general interest in supramolecular chemistry: the achievement of chiral helical organizations with controlled structures. This work provides a strategy to obtain supramolecular polymers in which a chiral helical conformation has been induced by a noncovalent association, that is, through hydrogen bonding. Polycatenar 2,4,6-triarylamino-1,3,5-triazines, which organize into columnar mesophases and are susceptible to H-bonding interactions, were chosen as a starting point to build up the chiral supramolecular structure. The stacking of these mesogens has been forced to wind in a helical way by means of H-bond association with (R)-3-methyladipic acid, within the mesophase. The optically active columnar organization has been studied in depth by optical microscopy, differential scanning calorimetry (DSC), X-ray diffraction, and circular dichroism. Formation of stable complexes between the triazine units and (R)-3-methyladipic acid has also been investigated by means of NMR diffusion-ordered spectroscopy (DOSY) experiments in chloroform.