Tetraphenylantimony carboxylates in the cascade Pd-catalyzed C-phenylation reaction of methyl acrylate in the presence of peroxide

Tetraphenylantimony(V) carboxylates have been used in the palladium-catalyzed C-phenylation reaction of methyl acrylate in the presence of (PhCO₂)₂ or t-BuOOH under mild conditions (50 °C). The peroxides promote a cascade participation of the organoantimony compound and result in the transfer of three phenyl groups. Organoantimony intermediates have been isolated from the reaction.     

Fundamental solutions of the acoustic and diffusion equations in nonhomogeneous medium

A fundamental solution of the acoustical equation with a variable refraction coefficient is constructed. The solution satisfies the limiting absorption and radiation conditions. The optimal high frequency estimate is proved for square means of the solution. The source function for the diffusion equation is a by-product of this construction. Partially supported by a stipend of the Mathematical Scientific Research Institute at Berkeley, 2001.     

A conjecture of M. J. Taylor concerning determinantal congruences

Let G be a finite group. The class group of the group ring of G is a quotient of the idèlic homomorphisms of R(G) by the global functions and the determinantal functions. Using Explicit Brauer Induction, we prove Adams operations, applied to determinantal functions, satisfy some congruences which were conjectured by M. J. Taylor. As an application, we construct some new maps defined on the class group.In memory of J. Frank Adams (1930–1989)Research partially supported by NSERC Grant # 0GP0042580.     

2,12‐Dichloro‐10,20‐diphenyl‐5,7,15,17‐tetrahydro‐6H,16H‐dibenzo[d,l][1,9,2,6,10,14]dioxotetraazacyclohexadecine‐6,16‐dione dioxane solvate as a potential macrocyclic hexadentate ligand

The macrocyclic title compound crystallizes as a dioxane solvate, C₃₀H₂₂Cl₂N₄O₄·C₄H₈O₂, with two independent formula units in the unit cell. The observed syn conformation is controlled by both intramolecular N—H...O hydrogen bonds and intermolecular C—H...π interactions. The relative macrocyclic inner bore is estimated to be 4.19 Å. In the crystal structure, molecules form dimers via intermolecular C—H...π interactions, and these dimers are, in turn, linked to form columns along the a axis by intermolecular C—H...O hydrogen bonds. Both X‐ray diffraction analysis and density functional theory (DFT) calculations reveal that the macrocycle possesses very high flexibility. This property, as well as the presence of six donor atoms accessible for coordination, makes the title macrocycle a very promising ligand for complexation with the majority of transition metals.     

Gradient- and Sensitivity-Enhanced TOCSY Experiments

A pulsed field gradient version of the sensitivity-enhanced 2D TOCSY experiment is proposed which yields high-quality spectra with improved sensitivity and a minimum of two scans pert₁increment. For rapid acquisition of 1D TOCSY spectra, the 1D DPFGSE–TOCSY experiment was modified to include phase-encoded multiple-selective excitation followed by a simple spectral editing. Combination of these two building blocks is used in a sensitivity-enhanced 2D analog of the 3D TOCSY–TOCSY experiment which provides an efficient tool for resolving severely overlapped signals of oligomers in short experimental time.     

Kac-Moody group representations and generalization of the Sugawara construction of the Virasoro algebra

We discuss the dynamical structure of the semidirect product of the Virasoro and affine Kac-Moody groups within the framework of a group quantization formalism. This formalism provides a realization of the Virasoro algebra acting on Kac-Moody Fock states which generalizes the Sugawara construction. We also give an explicit construction of the standard Kac-Moody group representations associated with strings on SU(2) and recover, in particular, the renormalization factor of L(z) Research partially supported by the Conselleria de Cultura de la Generalitat Valenciana, the Plan de Formacion del Personal Investigador, the Comision Asesora de Investigacion Cientifica y Tecnica (CAICYT), and The British Council.     

Oriented immobilization of Desulfovibrio gigas hydrogenase onto carbon electrodes by covalent bonds for nonmediated oxidation of H2

The orientation of hydrogenase bound covalently to a pyrolytic graphite edge electrode modified with a 4-aminophenyl monolayer can be modulated via electrostatic interactions during the immobilization step. At low ionic strength and when the amino groups of the electrode surface are mostly protonated, the hydrogenase is immobilized with the negatively charged region that surrounds its 4Fe4S cluster nearer to the protein surface facing the electrode. This allows direct electron transfer between the immobilized hydrogenase and the electrode, which is observed by the strong catalytic currents measured in the presence of the H2 substrate. Therefore, a very stable enzymatic electrode is produced that catalyzes nonmediated H2 oxidation.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Gemini-induced columnar jointing in vitreous ice. Cryo-HRSEM as a tool for discovering new colloidal morphologies

A gemini surfactant is able to promote columnar jointing in vitreous ice where long pillars, often of hexagonal cross section, are formed. This jointing is visible by cryo-high-resolution scanning electron microscopy (cryo-HRSEM), in which colloidal suspensions in bulk water are cooled rapidly in liquid ethane, thereby avoiding the potential artifacts with other types of EM. The jointing is proposed to arise from a new type of colloidal morphology where the surfactant self-assembles into hexagonal columns. Evidence for this mechanism comes from a cryo-HRSEM photo of an ice-free hexagonal "skeleton" composed of surfactant. Cryo-HRSEM, a method that is just beginning to realize its potential, would seem to have a promising future in the discovery of additional and as yet unimagined colloidal structures.