Structure of the attraction zones of the final states in the presence of dynamical period doubling bifurcations

The structure of the attraction zones of the final states associated with dynamical period doubling bifurcations is investigated. It is found that on the “initial value—transition rate” plane the attraction zones of the two possible final states alternate with each other and that a subdivision of the attraction regions occurs with a decrease in the transition rate. It is shown that the boundaries of the attraction zones are smeared out because of the effect of noise and in this situation the fine structure of the attraction zones is destroyed. As analytical and numerical calculations have shown, the critical value of the noise variance, corresponding to the boundary between the dynamical (or predictable) and stochastic (or unpredictable) modes, has a power-law dependence on the transition rate with a typical exponent value of one. The existence of “noise” invariants is also observed: the integrated (over all initial values) probability of achieving the final state is invariant with respect to the noise level. Zh. éksp. Teor. Fiz. 113, 369–380 (January 1998)     

Gradient- and Sensitivity-Enhanced TOCSY Experiments

A pulsed field gradient version of the sensitivity-enhanced 2D TOCSY experiment is proposed which yields high-quality spectra with improved sensitivity and a minimum of two scans pert₁increment. For rapid acquisition of 1D TOCSY spectra, the 1D DPFGSE–TOCSY experiment was modified to include phase-encoded multiple-selective excitation followed by a simple spectral editing. Combination of these two building blocks is used in a sensitivity-enhanced 2D analog of the 3D TOCSY–TOCSY experiment which provides an efficient tool for resolving severely overlapped signals of oligomers in short experimental time.     

Kac-Moody group representations and generalization of the Sugawara construction of the Virasoro algebra

We discuss the dynamical structure of the semidirect product of the Virasoro and affine Kac-Moody groups within the framework of a group quantization formalism. This formalism provides a realization of the Virasoro algebra acting on Kac-Moody Fock states which generalizes the Sugawara construction. We also give an explicit construction of the standard Kac-Moody group representations associated with strings on SU(2) and recover, in particular, the renormalization factor of L(z) Research partially supported by the Conselleria de Cultura de la Generalitat Valenciana, the Plan de Formacion del Personal Investigador, the Comision Asesora de Investigacion Cientifica y Tecnica (CAICYT), and The British Council.     

Insights into the structure of cyclohexane from femtosecond degenerate four-wave mixing spectroscopy and ab initio calculations

In this paper, we report the use of femtosecond time-resolved degenerate four-wave mixing rotationally resolved spectroscopy to obtain very accurate structural information on the symmetric top cyclohexane. Apart from highlighting the versatility of this method in determining accurate structures of large and complex molecules without dipole moment, the present study also details the comparison of the experimentally determined rotational constant B(0) with that obtained from high-level ab initio calculations. The theoretical calculations, which were carried out at both the second-order M?ller-Plesset (MP2) and coupled-cluster with single, double, and perturbative triple substitutions [CCSD(T)] levels of theory, also take into account vibrational averaging effects. A detailed investigation of the vibrational averaging effects reveals that the corrections emerge from only the six highly symmetric A(1g) modes, a justification of which is provided by an analysis of these modes.     

Origin of high second- and third-order nonlinear optical response in ammonio/borato diphenylpolyene zwitterions: the remarkable role of polarized aromatic groups

We present a quantum-chemical analysis of the molecular structure and second- and third-order polarizabilities in a series of promising nonlinear optical (NLO) chromophores, the zwitterionic ammonio/borato diphenylpolyenes, R3N+Ph(C=C)nPhB-R3, whose synthesis has been reported recently. The molecular geometries are obtained via MP2/6-31G optimization, while the NLO properties are calculated with the INDO Hamiltonian using the sum-over-states and finite-field real-space methods. The real-space approach allows the direct evaluation of the NLO-active segments of the molecules, while the sum-over-states results illustrate the virtual excitations and charge-transfer pathways that are essential in the NLO response. Both methods highlight the remarkable and unexpected result that it is the strongly polarized phenylene groups that play the key role in generating a high NLO response.     

Synthesis and anion binding properties of 2,5-diamidothiophene polypyrrole Schiff base macrocycles

[reaction: see text] Two easy-to-synthesize polypyrrolic 2,5-diamidothiophene Schiff base macrocycles are reported, along with their anion binding properties as determined via UV-vis spectroscopic titrations carried out in dichloroethane. There is a striking difference between the interactions with anions of the two macrocycles, a finding ascribed to differences in their rigidity. For example, the more flexible dipyrromethane-derived macrocycle displays a 1.2:1 hydrogen sulfate versus nitrate selectivity, while its more rigid bipyrrole-derived congener shows a 7.4:1 selectivity in favor to hydrogen sulfate.     

Oriented immobilization of Desulfovibrio gigas hydrogenase onto carbon electrodes by covalent bonds for nonmediated oxidation of H2

The orientation of hydrogenase bound covalently to a pyrolytic graphite edge electrode modified with a 4-aminophenyl monolayer can be modulated via electrostatic interactions during the immobilization step. At low ionic strength and when the amino groups of the electrode surface are mostly protonated, the hydrogenase is immobilized with the negatively charged region that surrounds its 4Fe4S cluster nearer to the protein surface facing the electrode. This allows direct electron transfer between the immobilized hydrogenase and the electrode, which is observed by the strong catalytic currents measured in the presence of the H2 substrate. Therefore, a very stable enzymatic electrode is produced that catalyzes nonmediated H2 oxidation.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.