The ionization constants of alpha-alanine in NaCl at 25 degrees. Effect of the ionic strength based on three models

In the present work we obtained the experimental pKs of the amino acid alpha-alanine in NaCl at 25 degrees and different ionic strengths. The equilibrium constants have been potentiometrically determined with a commercial glass electrode and the results analysed through three models: two directly based on the Pitzer and Scatchard approaches to the ion specific interaction theory and the other based on a simpler modification of the Debye-Hückel equation. The three models fit the data reasonably well and the extrapolated pK values obtained show a good agreement. The goodness of the ridge regression method cannot be probed in this case.     

Comparison of chemical properties of food products processed by conventional and ohmic heating

The effect of ohmic and conventional heat processing of different food products on their chemical and physical parameters was studied. Depending on the food being analysed, parameters such as pH, total solids, ash, titratable acidity, ascorbic acid, total sugars, total fatty acids, total phenolic compounds, and anthocyanins content were determined before and after ohmic and conventional pasteurization techniques and the results were compared using one-way analysis of variance. In goat milk samples treated by ohmic technology the pH value (6.58) and total fatty acids content in milk fat (86.5 mass %) were comparable to those found in milk treated by conventional process, however, ohmically treated samples presented a lower content of lactic acid, 0.13 %. In cloudberry jam samples treated by ohmic technology the results of some of the main parameters tested, such as total sugar content 46.1 mass %, ascorbic acid content 2.83 mass %, and titratable acidity 6.01 mass % (as citric acid) did not show significant differences when compared with samples treated by conventional technology. Presented at the 33rd International Conference of the Slovak Society of Chemical Engineering, Tatranské Matliare, 22–26 May 2006.     

Single-step preparation and catalytic activity of mesoporous MCM-41 and SBA-15 silicas functionalized with perfluoroalkylsulfonic acid groups analogous to Nafion

Preparation of hybrid organic-inorganic MCM-41 and SBA-15 silicas functionalized with perfluoroalkylsulfonic acid groups has been achieved in a single step by reacting the mesoporous silicas with 1,2,2-trifluoro-2-hydroxy-1-trifluoromethylethane sulfonic acid beta-sultone; the catalysts showed higher activity than commercial Nafion-silica composite for the esterification of long chain fatty acids with ethanol.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Effect of ionic strength on the formal potential of the glass electrode in various saline media

We examined the variation with ionic strength (I, adjusted with KCl, KNO₃, KBr, NaCl or NaClO₄) of the formal potential (E_const) for glass electrodes exhibiting a Nernstian response (i.e. E_cell=E_const−s log [H⁺]). For this purpose, we investigated the different factors included in the formal potential, so we obtained reported values for the liquid junction potential as a function of ionic strength and determined the logarithm of the activity coefficient for the proton in various saline media, using Pitzer equations.     

Synthesis and Structural Characterization of [Mn(ethyl isonicotinate)(2)(N(3))(2)](n)(), a Two-Dimensional Alternating Ferromagnetic-Antiferromagnetic Compound. Magnetostructural Correlations for the End-to-End Pseudohalide-Manganese System

Three compounds with formula [Mn(L)(2)(N(3))(2)](n)(), in which L is 4-acpy = 4-acetylpyridine (1), Etinc = ethyl isonicotinate (2), and py = pyridine (3), have been studied from the magnetic point of view. The new compound [Mn(L)(2)(N(3))(2)](n)() (2) crystallizes in the monoclinic system, space group P2(1)/a (No. 14), formula [C(16)H(18)MnN(8)O(4)], with a = 15.176(5) ?, b = 9.060(3) ?, c = 15.760(6) ?, beta = 111.62(3) degrees, and Z = 4. Compounds 1 and 2 are two-dimensional systems, whereas 3 is a 3-D compound. Compound 2 shows ferromagnetic Mn(2)(N(3))(2) dimeric entities linked antiferromagnetically to the four neighboring dimeric entities by four end-to-end azido bridges, leading to an alternate ferromagnetic-antiferromagnetic two-dimensional compound. MO calculations have been performed to study the superexchange pathway for the manganese 1,3-azido system.     

A novel one-pot method for the preparation of pyrazoles by 1,3-dipolar cycloadditions of diazo compounds generated in situ

A convenient one-pot procedure for the preparation of pyrazoles by 1,3-dipolar cycloaddition of diazo compounds generated in situ has been developed. Diazo compounds derived from aldehydes were reacted with terminal alkynes to furnish regioselectively 3,5-disubstituted pyrazoles. Furthermore, the reaction of N-vinylimidazole and diazo compounds derived from aldehydes gave exclusively 3-substituted pyrazoles in a one-pot process.     

Fluorescence study of the solubilization of benzo[a]pyrene: application to its detection in coal washing waters

The solubilization of benzo[a]pyrene by organic solvents (dioxane, toluene and dichloromethane) and a surfactant (Triton X-100) was investigated. These media were successfully used for the determination of benzo[a]pyrene using fluorescence detection, with excellent limits of detection and large linear analytical ranges. Benzo[a]pyrene was detected in coal washing waters using liquid chromatography with fluorescence detection. The stability of this compound in dioxane was also examined.     

Expeditious synthesis of porphyrin-cobaltacarborane conjugates

Two porphyrin-cobaltacarborane conjugates and were prepared in high yields via a nucleophilic ring-opening reaction of . These novel boron-rich and fluorescent compounds have potential application as boron delivery agents for the boron neutron capture therapy of tumors.