Identification of Human Dihydroorotate Dehydrogenase Inhibitor by a Pharmacophore-Based Virtual Screening Study

Human dihydroorotate dehydrogenase (hDHODH) is an enzyme belonging to a flavin mononucleotide (FMN)-dependent family involved in de novo pyrimidine biosynthesis, a key biological pathway for highly proliferating cancer cells and pathogens. In fact, hDHODH proved to be a promising therapeutic target for the treatment of acute myelogenous leukemia, multiple myeloma, and viral and bacterial infections; therefore, the identification of novel hDHODH ligands represents a hot topic in medicinal chemistry. In this work, we reported a virtual screening study for the identification of new promising hDHODH inhibitors. A pharmacophore-based approach combined with a consensus docking analysis and molecular dynamics simulations was applied to screen a large database of commercial compounds. The whole virtual screening protocol allowed for the identification of a novel compound that is endowed with promising inhibitory activity against hDHODH and is structurally different from known ligands. These results validated the reliability of the in silico workflow and provided a valuable starting point for hit-to-lead and future lead optimization studies aimed at the development of new potent hDHODH inhibitors.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Ambivalent role of metal chlorides in ring opening reactions of 2H-azirines: synthesis of imidazoles,pyrroles and pyrrolinones

2H-Azirines were found to react with imines, enaminones and enaminoesters in the presence of metal salts. Imidazoles, pyrroles and new pyrrolinones derivatives are isolated in good overall yields. The role of metal salts was investigated as they can act as Lewis acids or electron donors. Mechanisms are proposed suggesting that imidazoles arise from addition of azirine to imines via radical or ionic mechanism; pyrroles and pyrrolinones are obtained from azirines with enamino derivatives when the salt acts as a Lewis acid. In the latter case the properties of the metallic compound influence the reaction regioselectivity.     

MGM Optimal convergence for certain (multilevel) structured linear systems

We present a multigrid algorithm to solve linear systems whose coefficient metrices belongs to circulant, Hartley or τ multilevel algebras and are generated by a nonnegative multivariate polynomial f. It is known that these matrices are banded (with respect to their multilevel structure) and their eigenvalues are obtained by sampling f on uniform meshes, so they are ill‐conditioned (or singular, and need some corrections) whenever f takes the zero value. We prove the proposed metod to be optimal even in presence of ill‐conditioning: if the multilevel coefficient matrix has dimension ni at level i, i = 1, … , d, then only ni operations are required on each iteration, but the convergence rate keeps constant with respect to N(n) as it depends only on f. The algorithm can be extended to multilevel Toeplitz matrices too.     

Electroluminescence of silicon nanocrystals in MOS structures

We have studied the structural, electrical and optical properties of MOS devices, where the dielectric layer consists of a substoichiometric SiO_x (x<2) thin film deposited by plasma-enhanced chemical vapor deposition. After deposition the samples were annealed at high temperature (>1000 °C) to induce the separation of the Si and the SiO₂ phases with the formation of Si nanocrystals embedded in the insulating matrix. We observed at room temperature a quite intense electroluminescence (EL) signal with a peak at ∼850 nm. The EL peak position is very similar to that observed in photoluminescence in the very same device, demonstrating that the observed EL is due to electron–hole recombination in the Si nanocrystals and not to defects. The effects of the Si concentration in the SiO_x layer and of the annealing temperature on the electrical and optical properties of these devices are also reported and discussed. In particular, it is shown that by increasing the Si content in the SiO_x layer the operating voltage of the device decreases and the total efficiency of emission increases. These data are reported and their implications discussed. Received: 31 August 2001 / Accepted: 3 September 2001 / Published online: 17 October 2001     

Peroxynitrite decomposition catalyst prevents apoptotic cell death in a human astrocytoma cell line incubated with supernatants of HIV-infected macrophages

Background  

Oxidative stress has shown to contribute in the mechanisms underlying apoptotic cell death occuring in AIDS-dementia complex. Here we investigated the role of peroxynitrite in apoptosis occurring in astroglial cells incubated with supernatants of HIV-infected human primary macrophages (M/M).     

EEG Fractal Analysis Reflects Brain Impairment after Stroke

Stroke is the commonest cause of disability. Novel treatments require an improved understanding of the underlying mechanisms of recovery. Fractal approaches have demonstrated that a single metric can describe the complexity of seemingly random fluctuations of physiological signals. We hypothesize that fractal algorithms applied to electroencephalographic (EEG) signals may track brain impairment after stroke. Sixteen stroke survivors were studied in the hyperacute (<48 h) and in the acute phase (∼1 week after stroke), and 35 stroke survivors during the early subacute phase (from 8 days to 32 days and after ∼2 months after stroke): We compared resting-state EEG fractal changes using fractal measures (i.e., Higuchi Index, Tortuosity) with 11 healthy controls. Both Higuchi index and Tortuosity values were significantly lower after a stroke throughout the acute and early subacute stage compared to healthy subjects, reflecting a brain activity which is significantly less complex. These indices may be promising metrics to track behavioral changes in the very early stage after stroke. Our findings might contribute to the neurorehabilitation quest in identifying reliable biomarkers for a better tailoring of rehabilitation pathways.     

Quantum Probes for the Characterization of Nonlinear Media

Active optical media leading to interaction Hamiltonians of the form H=λ˜(a+a†)ζ represent a crucial resource for quantum optical technology. In this paper, we address the characterization of those nonlinear media using quantum probes, as opposed to semiclassical ones. In particular, we investigate how squeezed probes may improve individual and joint estimation of the nonlinear coupling λ˜ and of the nonlinearity order ζ. Upon using tools from quantum estimation, we show that: (i) the two parameters are compatible, i.e., the may be jointly estimated without additional quantum noise; (ii) the use of squeezed probes improves precision at fixed overall energy of the probe; (iii) for low energy probes, squeezed vacuum represent the most convenient choice, whereas for increasing energy an optimal squeezing fraction may be determined; (iv) using optimized quantum probes, the scaling of the corresponding precision with energy improves, both for individual and joint estimation of the two parameters, compared to semiclassical coherent probes. We conclude that quantum probes represent a resource to enhance precision in the characterization of nonlinear media, and foresee potential applications with current technology.     

Cosmology with Gravitational Waves: A Review

Standard sirens have been the central paradigm in gravitational-wave cosmology so far. From the gravitational wave signature of compact star binaries, it is possible to measure the luminosity distance of the source directly, and if additional information on the source redshift is provided, a measurement of the cosmological expansion can be performed. This review article discusses several methodologies that have been proposed to use gravitational waves for cosmological studies. Methods that use only gravitational-wave signals and methods that use gravitational waves in conjunction with additional observations such as electromagnetic counterparts and galaxy catalogs will be discussed. The review also discusses the most recent results on gravitational-wave cosmology, starting from the binary neutron star merger GW170817 and its electromagnetic counterpart and finishing with the population of binary black holes, observed with the third Gravitational-wave Transient Catalog GWTC–3.