Identification of Human Dihydroorotate Dehydrogenase Inhibitor by a Pharmacophore-Based Virtual Screening Study

Human dihydroorotate dehydrogenase (hDHODH) is an enzyme belonging to a flavin mononucleotide (FMN)-dependent family involved in de novo pyrimidine biosynthesis, a key biological pathway for highly proliferating cancer cells and pathogens. In fact, hDHODH proved to be a promising therapeutic target for the treatment of acute myelogenous leukemia, multiple myeloma, and viral and bacterial infections; therefore, the identification of novel hDHODH ligands represents a hot topic in medicinal chemistry. In this work, we reported a virtual screening study for the identification of new promising hDHODH inhibitors. A pharmacophore-based approach combined with a consensus docking analysis and molecular dynamics simulations was applied to screen a large database of commercial compounds. The whole virtual screening protocol allowed for the identification of a novel compound that is endowed with promising inhibitory activity against hDHODH and is structurally different from known ligands. These results validated the reliability of the in silico workflow and provided a valuable starting point for hit-to-lead and future lead optimization studies aimed at the development of new potent hDHODH inhibitors.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Synthesis and characterization of an MRI Gd‐based probe designed to target the translocator protein

DPA‐713 is the lead compound of a recently reported pyrazolo[1,5‐a]pyrimidineacetamide series, targeting the translocator protein (TSPO 18 kDa), and as such, this structure, as well as closely related derivatives, have been already successfully used as positron emission tomography radioligands. On the basis of the pharmacological core of this ligands series, a new magnetic resonance imaging probe, coded DPA‐C₆‐(Gd)DOTAMA was designed and successfully synthesized in six steps and 13% overall yield from DPA‐713. The Gd‐DOTA monoamide cage (DOTA = 1,4,7,10‐tetraazacyclododecane‐1,4,7,10‐tetraacetic acid) represents the magnetic resonance imaging reporter, which is spaced from the phenylpyrazolo[1,5‐a]pyrimidineacetamide moiety (DPA‐713 motif) by a six carbon‐atom chain. DPA‐C₆‐(Gd)DOTAMA relaxometric characterization showed the typical behavior of a small‐sized molecule (relaxivity value: 6.02 mM^?1 s^?1 at 20 MHz). The good hydrophilicity of the metal chelate makes DPA‐C₆‐(Gd)DOTAMA soluble in water, affecting thus its biodistribution with respect to the parent lipophilic DPA‐713 molecule. For this reason, it was deemed of interest to load the probe to a large carrier in order to increase its residence lifetime in blood. Whereas DPA‐C₆‐(Gd)DOTAMA binds to serum albumin with a low affinity constant, it can be entrapped into liposomes (both in the membrane and in the inner aqueous cavity). The stability of the supramolecular adduct formed by the Gd‐complex and liposomes was assessed by a competition test with albumin. Copyright © 2013 John Wiley & Sons, Ltd.     

Ambivalent role of metal chlorides in ring opening reactions of 2H-azirines: synthesis of imidazoles,pyrroles and pyrrolinones

2H-Azirines were found to react with imines, enaminones and enaminoesters in the presence of metal salts. Imidazoles, pyrroles and new pyrrolinones derivatives are isolated in good overall yields. The role of metal salts was investigated as they can act as Lewis acids or electron donors. Mechanisms are proposed suggesting that imidazoles arise from addition of azirine to imines via radical or ionic mechanism; pyrroles and pyrrolinones are obtained from azirines with enamino derivatives when the salt acts as a Lewis acid. In the latter case the properties of the metallic compound influence the reaction regioselectivity.     

Classical limit of the quantized hyperbolic toral automorphisms

The canonical quantization of any hyperbolic symplectomorphismA of the 2-torus yields a periodic unitary operator on aN-dimenional Hilbert space,N=1/h. We prove that this quantum system becomes ergodic and mixing at the classical limit (N,N prime) which can be interchanged with the time-average limit. The recovery of the stochastic behaviour out of a periodic one is based on the same mechanism under which the uniform distribution of the classical periodic orbits reproduces the Lebesgue measure: the Wigner functions of the eigenstates, supported on the classical periodic orbits, are indeed proved to become uniformly speread in phase space.     

Harmonic and intermodulation distortion modeling in IM-DD multi-band radio over fiber links exploiting injection locked lasers

A comprehensive numerical tool has been developed for the evaluation of the performances of Radio over Fiber (RoF) links intended for wireless signal distribution.At the transmitter end an appropriate set of rate equations allows to model the optical source as a solitary laser or as an appropriately injection locked laser. The optical channel is modeled putting into account the combined effect of fiber dispersion, laser source non ideal performances (e.g. non-linear effects, frequency chirp), and quadratic detection of the receiving photodiode. The simulation model developed can be a useful tool at the design stage allowing a preliminary evaluation of the characteristics of real RoF links.     

Ergodicity of a Single Particle Confined in a Nanopore

We analyze the dynamics of a gas particle moving through a nanopore of adjustable width with particular emphasis on ergodicity. We give a measure of the portion of phase space that is characterized by quasiperiodic trajectories which break ergodicity. The interactions between particle and wall atoms are mediated by a Lennard-Jones potential, so that an analytical treatment of the dynamics is not feasible, but making the system more physically realistic. In view of recent studies, which proved non-ergodicity for systems with scatterers interacting via smooth potentials, we find that the non-ergodic component of the phase space for energy levels typical of experiments, is surprisingly small, i.e. we conclude that the ergodic hypothesis is a reasonable approximation even for a single particle trapped in a nanopore. Due to the numerical scope of this work, our focus will be the onset of ergodic behavior which is evident on time scales accessible to simulations and experimental observations rather than ergodicity in the infinite time limit.     

Passively Q-switched Tm:YLF laser

Stable passive Q-switching of a Tm: LiYF4 laser is obtained using polycrystalline Cr2+: ZnS as a saturable absorber. The achieved maximum pulse energy of 0.9 mJ and peak power of 65 kW for a pulse duration of ～14 ns represent substantial improvement and highest values for a passively Q-switched diode-pumped Tm laser operating at ～1.9 μm.