Which Extraction Solvents and Methods Are More Effective in Terms of Chemical Composition and Biological Activity of Alcea fasciculiflora from Turkey?

The bioactive content, antioxidant properties, and enzyme inhibition properties of extracts of Alcea fasciculiflora from Turkey prepared with different solvents (water, methanol, ethyl acetate) and extraction methods (maceration, soxhlet, homogenizer assisted extraction, and ultrasound assisted extraction) were examined in this study. UHPLC-HRMS analysis detected or annotated a total of 50 compounds in A. fasciculiflora extracts, including 18 hydroxybenzoic and hydroxycinnamic acids, 7 Hexaric acids, 7 Coumarins, 15 Flavonoids, and 3 hydroxycinnamic acid amides. The extracts had phenolic and flavonoid levels ranging from 14.25 to 24.87 mg GAE/g and 1.68 to 25.26 mg RE/g, respectively, in the analysis. Both DPPH and ABTS tests revealed radical scavenging capabilities (between 2.63 and 35.33 mg TE/g and between 13.46 and 76.27 mg TE/g, respectively). The extracts had reducing properties (CUPRAC: 40.38–78 TE/g and FRAP: 17.51–42.58 TE/g). The extracts showed metal chelating activity (18.28–46.71 mg EDTAE/g) as well as total antioxidant capacity (phosphomolybdenum test) (0.90–2.12 mmol TE/g). DPPH, ABTS, FRAP, and metal chelating tests indicated the water extracts to be the best antioxidants, while the ethyl acetate extracts had the highest overall antioxidant capacity regardless of the extraction technique. Furthermore, anti-acetylcholinesterase activity was identified in all extracts (0.17–2.80 mg GALAE/g). The water extracts and the ultrasound-assisted ethyl acetate extract were inert against butyrylcholinesterase, but the other extracts showed anti-butyrylcholinesterase activity (1.17–5.80 mg GALAE/g). Tyrosine inhibitory action was identified in all extracts (1.79–58.93 mg KAE/g), with the most effective methanolic extracts. Only the ethyl acetate and methanolic extracts produced by maceration and homogenizer aided extraction showed glucosidase inhibition (0.11–1.11 mmol ACAE/g). These findings showed the overall bioactivity of the different extracts of A. fasciculiflora and provided an overview of the combination of solvent type and extraction method that could yield bioactive profile and pharmacological properties of interest and hence, could be a useful reference for future studies on this species.     

Identification of Human Dihydroorotate Dehydrogenase Inhibitor by a Pharmacophore-Based Virtual Screening Study

Human dihydroorotate dehydrogenase (hDHODH) is an enzyme belonging to a flavin mononucleotide (FMN)-dependent family involved in de novo pyrimidine biosynthesis, a key biological pathway for highly proliferating cancer cells and pathogens. In fact, hDHODH proved to be a promising therapeutic target for the treatment of acute myelogenous leukemia, multiple myeloma, and viral and bacterial infections; therefore, the identification of novel hDHODH ligands represents a hot topic in medicinal chemistry. In this work, we reported a virtual screening study for the identification of new promising hDHODH inhibitors. A pharmacophore-based approach combined with a consensus docking analysis and molecular dynamics simulations was applied to screen a large database of commercial compounds. The whole virtual screening protocol allowed for the identification of a novel compound that is endowed with promising inhibitory activity against hDHODH and is structurally different from known ligands. These results validated the reliability of the in silico workflow and provided a valuable starting point for hit-to-lead and future lead optimization studies aimed at the development of new potent hDHODH inhibitors.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Ambivalent role of metal chlorides in ring opening reactions of 2H-azirines: synthesis of imidazoles,pyrroles and pyrrolinones

2H-Azirines were found to react with imines, enaminones and enaminoesters in the presence of metal salts. Imidazoles, pyrroles and new pyrrolinones derivatives are isolated in good overall yields. The role of metal salts was investigated as they can act as Lewis acids or electron donors. Mechanisms are proposed suggesting that imidazoles arise from addition of azirine to imines via radical or ionic mechanism; pyrroles and pyrrolinones are obtained from azirines with enamino derivatives when the salt acts as a Lewis acid. In the latter case the properties of the metallic compound influence the reaction regioselectivity.     

On the integrability of Degasperis–Procesi equation: Control of the Sobolev norms and Birkhoff resonances

We consider the dispersive Degasperis–Procesi equation $u_t?u_{xxt}?\mathtt{c}{u}_{xxx}+4\mathtt{c}{u}_x?u{u}_{xxx}?3u_x{u}_{xx}+4u{u}_x=0$ with $\mathtt{c}\in \mathbb{R}?\{0\}$. In [15] the authors proved that this equation possesses infinitely many conserved quantities. We prove that there are infinitely many of such constants of motion which control the Sobolev norms and which are analytic in a neighborhood of the origin of the Sobolev space $H^s$ with $s\ge 2$, both on $\mathbb{R}$ and $\mathbb{T}$. By the analysis of these conserved quantities we deduce a result of global well-posedness for solutions with small initial data and we show that, on the circle, the formal Birkhoff normal form of the Degasperis–Procesi at any order is action-preserving.     

Fractional powers of the noncommutative Fourier's law by the S‐spectrum approach

Let e_?, for ? = 1,2,3, be orthogonal unit vectors in and let be a bounded open set with smooth boundary ?Ω. Denoting by a point in Ω, the heat equation, for nonhomogeneous materials, is obtained replacing the Fourier law, given by the following: into the conservation of energy law, here a, b, are given functions. With the S‐spectrum approach to fractional diffusion processes we determine, in a suitable way, the fractional powers of T. Then, roughly speaking, we replace the fractional powers of T into the conservation of energy law to obtain the fractional evolution equation. This method is important for nonhomogeneous materials where the Fourier law is not simply the negative gradient. In this paper, we determine under which conditions on the coefficients a, b, the fractional powers of T exist in the sense of the S‐spectrum approach. More in general, this theory allows to compute the fractional powers of vector operators that arise in different fields of science and technology. This paper is devoted to researchers working in fractional diffusion and fractional evolution problems, partial differential equations, and noncommutative operator theory.     

Baroque glass mosaics from the Capela de São João Baptista (Chapel of Saint John the Baptist,Lisbon): unveiling the glassmaking records

For the first time, 18th‐century glass mosaics from the Capela de São João Baptista (Chapel of St. John the Baptist, Lisbon) were analysed by Raman microscopy (RM). This masterpiece in baroque mosaic art had one of its major contributors the most famous glassmaker in Rome, Alessio Mattioli. Mattioli was celebrated because of the opacity of his mosaics and the astonishing number of hues he was able to produce for mosaic decorating Saint Peter's Basilica in Rome. This study had two goals in mind: (1) characterising the materials involved in the manufacture of these glass mosaics and (2) lengthening the understanding of what was left of Mattioli's glassmaking records. As expected the mosaics presented a high ratio of crystalline phases, making RM the ideal technique for non‐destructive analysis. The mosaics contained a white ‘background’ or opacifier added identified as Ca₂Sb₂O₇. The yellow tesserae are opacified with lead antimonate (Pb₂Sb₂O₇) and ternary oxides, structures related to lead antimonate but with other ions entering the position of Sb⁴⁺ (namely Sn⁴⁺). Those ternary oxides are pervasive in most colours, admixed with other colorants. The red, orange, pink and brown colours were accomplished with cuprous oxide (Cu₂O) and admixed with a ternary oxide to create the latter three colours. The red copper‐based colours were made according to the procedure to make a ruby copper glass and with the exception of the red colour; all mosaics exhibited a dark layer on each side of the mosaic, named scorzetta. This layer is the outcome of an oxidation reaction because of a quick cooling process and is composed of CuO. Finally the blue and green colours are accomplished with cobalt oxide and copper oxide, respectively, and the purple/black colour with manganese oxide. Copyright © 2015 John Wiley & Sons, Ltd.