Connection between backbending and high-spin isomer decay in 179W

A new 710 ns isomer in ¹⁷⁹W is found to decay directly into backbending region of the $\text{7}\text{2}{}^{\mathrm{-}}\text{(514)}$ gorund-state band. The $\text{i}{}_{\mathrm{<mtext>13</mtext><mtext>2</mtext>}}$ band is observed up to spin $\text{41}\text{2}$ and shows no evidence for backbending at core rotational frequencies, where the effect is observed in the ¹⁷⁹W and ¹⁸⁰W ground-state bands.     

Internal versus terminal metalation of double-helical oligodeoxyribonucleotides

The formation of adducts between cis-[Pt(NH(3))(2)Cl(2)], Zn(II), and Mn(II) and double-stranded oligodeoxynucleotides was studied by 1D and 2D (1)H, (31)P, and (15)N NMR spectroscopy. For labile adducts involving Zn(II) and Mn(II), both (1)H chemical shifts (Zn(II)) and (1)H line-broadening effects (Mn(II)) showed that in the hexamer [d(GGCGCC)](2) I, the terminal G(1)-N7 is the exclusive binding site, while for the dodecamer [d(GGTACCGGTACC)](2) II, which contains both a terminal and internal GG pair, the preference for metal binding is the internal guanine G(7). Zn(II) binding to II was confirmed by natural-abundance 2D [(1)H,(15)N] HMBC NMR spectroscopy, which unambiguously showed that G(7)-N7 is the preferred binding site. The long duplex [d(GGTATATATACCGGTATATATACC)](2) III was expected to have a more pronounced accumulation of electrostatic potential towards the central part of the sequence (vs the terminal part) than does II. However, the Zn(II) titration of III showed no increase in coordination with the internal Gs (vs the terminal Gs), compared with what was observed for II. The reaction between the nonlabile metal complex cis-[PtCl(2)((15)NH(3))(2)] (cisplatin) and II showed a slight preference for the internal GG pair over the terminal GG pair. However, when the diaqua form of cisplatin cis-[Pt((15)NH(3))(2)(H(2)O)(2)] was reacted with II a more pronounced binding preference for the internal GG pair was observed.     

Bioorthogonal Chemistry: Fishing for Selectivity in a Sea of Functionality

The study of biomolecules in their native environments is a challenging task because of the vast complexity of cellular systems. Technologies developed in the last few years for the selective modification of biological species in living systems have yielded new insights into cellular processes. Key to these new techniques are bioorthogonal chemical reactions, whose components must react rapidly and selectively with each other under physiological conditions in the presence of the plethora of functionality necessary to sustain life. Herein we describe the bioorthogonal chemical reactions developed to date and how they can be used to study biomolecules.     

Lifetimes of triaxial superdeformed states in 163Lu and 164Lu

Lifetimes of states in the yrast superdeformed bands of ¹⁶³Lu and ¹⁶⁴Lu were determined in a Doppler-shift attenuation-method experiment. From fractional Doppler shifts and line shapes, average transition quadrupole moments, Q _t = 8.2_-0.6 ^+1.0 b and 7.1_-0.6 ^+0.5 b, were deduced for one of the bands in ¹⁶³Lu and ¹⁶⁴Lu, respectively. These values are much larger than the quadrupole moment of the normal-deformed yrast band in ¹⁶³Yb, Q _t = 4.9_-0.4 ^+1.3 b, that was also determined in this experiment. Comparison to cranking calculations indicates that both superdeformed bands correspond to a local potential energy minimum with a pronounced triaxiality, γ∼ 20^°. Received: 8 November 2001 / Accepted: 9 January 2002     

A new high-spin isomer in 145Eu

In ¹⁴⁵Eu a high-spin isomer with E _level = 8528 keV and T _1/2 = (3.7 ± 0.4) ns has been observed. The data were obtained by in-beam γ-ray spectroscopy using the reaction ¹²²Sn(²⁷Al,4n)¹⁴⁵Eu at 127 MeV performed at the NORD-BALL spectrometer in Roskilde.     

Comparative quadrupole moments of triaxial superdeformed states in 163, 164, 165Lu

Average transition quadrupole moments in the yrast triaxial superdeformed bands of ¹⁶³Lu, ¹⁶⁴Lu and ¹⁶⁵Lu were determined in a Doppler-shift attenuation-method experiment. Fractional Doppler shifts were determined in γ-ray coincidence spectra measured with the Gammasphere array. The transition quadrupole moments derived from these data show a decrease from ¹⁶³Lu to ¹⁶⁵Lu which is not predicted by total-energy surface calculations. Received: 12 August 2002 / Accepted: 23 October 2002 / Published online: 10 December 2002 RID="a" ID="a"e-mail: schoenwa@iskp.uni-bonn.de Communicated by D. Schwalm     

Energy levels of 94Ru observed with the 96Ru(p,t) reaction

The level structure of the neutron-magic nucleus ⁹⁴Ru, up to an excitation energy of 4 MeV, has been studied by means of the (p, t) reaction. Particular emphasis was placed on a search for excited 0⁺ levels, none of which have been reported previously. Among new levels observed in this study are 0⁺ levels at 2.995, 3.615 and 3.770 MeV, and the 3^? octupole vibration at 2.965 MeV.     

(68)(28)Ni(40): Magicity versus superfluidity

The neutron-rich (66,68)Ni have been produced at GANIL via interactions of a 65.9A MeV 70Zn beam with a 58Ni target. Their reduced transition probability B(E2;0(+)(1)-->2+) has been measured for the first time by Coulomb excitation in a (208)Pb target at intermediate energy. The B(E2) value for (68)Ni(40) is unexpectedly small. An analysis in terms of large scale shell model calculations stresses the importance of proton core excitations to reproduce the B(E2) values and indicates the erosion of the N = 40 harmonic-oscillator subshell by neutron-pair scattering.