Synthesis of 7-thio-substituted 4-oxoquinoline-3-carboxylic acids with antibacterial activity

A series of C-7 thio-substituted 1-cyclopropyl-1,4-dihydro-4-oxoquinoline-3-carboxylic acids were prepared and tested for their antibacterial activity. Structure-activity relationships associated with the C-5 and C-7 substituents were discussed. Among the C-7 substituents including alkylthio, arylthio, heteroarylthio, and cyclic aminothio groups, a 2-aminoethylthio group was the best for enhancing in vitro antibacterial activity. The C-5 variants increased activity in the order OH less than F less than H less than NH2. Of compounds prepared in this work, 5-amino-7-(2-aminoethyl)thio-1-cyclopropyl-6,8-difluoro-1,4-dihydro-4 -oxo-quinoline-3-carboxylic acid (18) was the most active.     

Determination of purine nucleosides and their bases by high-performance liquid chromatography using co-immobilized enzyme reactors

A selective and sensitive assay of inosine, guanosine, hypoxanthine, guanine and xanthine by high-performance liquid chromatography with immobilized enzyme reactors was developed. The separation was achieved on a Capcell Pak C18 column (15 cm x 0.46 cm I.D.) with a mobile phase of 0.1 M phosphate buffer (pH 8.0) containing 7 mM sodium 1-hexanesulphonate and 0.1 mM p-hydroxyphenylacetic acid. The fluorimetric detection of hydrogen peroxide using immobilized peroxidase and p-hydroxyphenylacetic acid was applied to the assay of these compounds, which were oxidized to yield hydrogen peroxide in the presence of immobilized enzyme (purine nucleoside phosphorylase, guanase and xanthine oxidase). Enzyme reactions occurred sufficiently without post-column addition of reagents. Enzymes that catalysed the conversion of purine compounds were co-immobilized on aminopropyl controlled-pore glass packed in stainless-steel tubing. The detection limits were 30-200 pg per injection.     

Microscopic acid dissociation constants of 3,4-dihydroxyphenylpropionic acid and related compounds, and 3,4-dihydroxyphenylalanine (DOPA)

The dissociation constants of 3,4-dihydroxyphenylpropionic acid and related compounds and of DOPA were determined by potentiometric titration and complementary tristimulus colorimetry at 25 degrees and mu = 0.1 (NaClO(4)) in aqueous solution. The thermodynamic parameters were calculated from the values of the dissociation constants at various temperatures. The dissociation constants and corresponding thermodynamic parameters for the first phenol group of the catechols showed almost the same values as those of the phenol derivatives. In the dissociation of the second phenol group of the catechols, formation of an intramolecular hydrogen bond was indicated. The microscopic acid dissociation constants of 3,4-dihydroxyphenylacetic acid and 3,4-dihydroxyphenylpropionic acid were calculated by two different methods. In the physiological pH-region (pH 7.2-7.4), 3,4-hydroxyphenylpropionic acid is present in the carboxylate form, and the two possible monophenolate anions are present to the extent of about 45% and 40%, respectively, at pH 11.0. The twelve micro-constants for the eight chemical species from DOPA were similarly evaluated.     

Interaction of paramagnetic electron with highT c supercurrent in LaSrCuO studied by (μ−O) probe

The paramagnetic state of the muonic atom formed by the negative muon ( ^–) bound to the oxygen in highT _c LaSrCuO which was found in our recent ^– spin rotation experiments was applied to probe an interaction between the paramagnetic electron and the highT _c supercurrent. The observed enhanced spin relaxation rates of the ( ^–O) system in the superconducting state revealed the presence of such an interaction.     

Effect of aging, castration, and testosterone administration on ribonuclease and ribonuclease-inhibitor activities in the prostate of rats

Free ribonuclease (RNase)-inhibitor activities in both ventral and dorsal prostates had their highest peaks in 4-week-old rats and smallest peaks in around 7-week-old animals. Total RNase activity in the ventral prostate decreased overall with age, while that in the dorsal prostate increased. No significant amount of free RNase activity was found in either prostate. Weight, protein content, and free RNase-inhibitor activity in both prostates decreased after castration and increased after administration of testosterone to castrated rats. Total RNase activity in the ventral prostate was increased by castration and decreased by testosterone administration. In the dorsal prostate, total RNase activity had two peaks, 7 d after castration and 2 d after testosterone administration. A large amount of free RNase activity was found in the ventral prostate 7 d after castration and this activity was decreased by testosterone administration. In the dorsal prostate, free RNase activity was not detected after castration and testosterone administration. These results suggest that changes in the level of RNase-inhibitor in both prostates are involved in the regulation of their RNA content through the control of free RNase activity.     

A Monoclonal Antibody Affects Chromophore Apoprotein Interactions of Phytochrome A

Abstract— A monoclonal antibody designated Mep-1 was raised against phytochrome A from pea ( Pisum sativum L.). The binding of this antibody (class IgG₁) to partially degraded phytochrome (114 kDa) caused a considerable increase in the far-red peak at the red-light-induced stationary state. The effect reached a plateau value when the antibody and phytochrome were present in approximately equimolar amounts. The dark transformation of the far-red-light-absorbing form to the red-light-absorbing form of the 114 kDa phytochrome was inhibited by the addition of the antibody. However, binding of the antibody to the undegraded 121 kDa phytochrome had no effects on the spectrum of the red-light-induced steady state. The site at which the antibody bound to phytochrome was determined to be between amino acid residues 256 and 383 of pea phytochrome A. This is the first report of a monoclonal antibody that enhances the far-red absorption of phytochrome in the red-light-induced photostationary state.     

Evaluation of hydrophobic interaction between acidic drugs and bovine serum albumin by reversed-phase high-performance liquid chromatography

The contribution of hydrophobic interaction to the protein binding of acidic drugs has been evaluated in terms of a new hydrophobic index (r-value), defined as the slope of the log-log plots of capacity factor vs. reciprocal of methanol concentration in an aqueous binary mobile phase, measured by the reversed-phase high-performance liquid chromatography. The logarithms of the binding constants (log K1) of the selected acidic drugs and the related aromatic carboxylic acids indicated linear relationship with their r-values, suggesting that the effect of hydrophobicity on protein binding can be explained similarly to that on the retention onto the reversed-phase stationary ligand.     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).