Development of a capillary electrophoretic method for the separation of diastereoisomers of a new human immunodeficiency virus protease inhibitor

A capillary electrophoretic (CE) method was developed for the separation of diastereoisomers of a new human immunodeficiency virus (HIV) protease inhibitor TMC114. In total 16 isomers of this drug have been synthesized (eight pairs of enantiomers). We succeeded in the separation of the eight diastereoisomers, but no enantiomers could be separated. Because of the high similarity and water-insolubility of these isomers, the separation is a real challenge. Different CE modes were tried out: capillary zone electrophoresis (CZE), nonaqueous capillary electrophoresis (NACE), micellar electrokinetic capillary chromatography (MEKC), and microemulsion electrokinetic capillary chromatography (MEEKC). Only MEEKC offered resolution of these compounds.     

Highly efficient redox isomerization of allylic alcohols at ambient temperature catalyzed by novel ruthenium-cyclopentadienyl complexes--new insight into the mechanism

A range of ruthenium cyclopentadienyl (Cp) complexes have been prepared and used for isomerization of allylic alcohols to the corresponding saturated carbonyl compounds. Complexes bearing CO ligands show higher activity than those with PPh3 ligands. The isomerization rate is highly affected by the substituents on the Cp ring. Tetra(phenyl)methyl-substituted catalysts rapidly isomerize allylic alcohols under very mild reaction conditions (ambient temperature) with short reaction times. Substituted allylic alcohols have been isomerized by employing Ru-Cp complexes. A study of the isomerization catalyzed by [Ru(Ph5Cp)(CO)2H] (14) indicates that the isomerization catalyzed by ruthenium hydrides partly follows a different mechanism than that of ruthenium halides activated by KOtBu. Furthermore, the lack of ketone exchange when the isomerization was performed in the presence of an unsaturated ketone (1 equiv), different from that obtained by dehydrogenation of the starting allylic alcohol, supports a mechanism in which the isomerization takes place within the coordination sphere of the ruthenium catalyst.     

NdFeO3 as a new electrocatalytic material for the electrochemical monitoring of dopamine

A new electrochemical sensor, based on NdFeO₃ nanoparticles as electrocatalytic material, was proposed here for the detection of dopamine (DA). NdFeO₃ nanoparticles were first synthesized by a simple thermal treatment method and subsequent annealing at high temperature (700 °C). The prepared electrocatalytic material has been characterized in detail by SEM-EDX, XRD, and Raman techniques. Characterization results display its sheet-like morphology, constituted by a porous network of very small orthorhombic NdFeO₃ nanoparticles. NdFeO₃ electrocatalytic material was then used to modify the working electrode of screen-printed carbon electrodes (SPCEs). Electrochemical tests demonstrated that NdFeO₃– modified screen-printed carbon electrode (NdFeO₃/SPCE) exhibited a remarkable enhancement of the dopamine electrooxidation, compared to the bare SPCE one. The analytical performance of the developed sensor has been evaluated for the detection of this analyte by means of the square-wave voltammetry (SWV) technique. The modified electrode showed two linear concentration ranges, from 0.5 to 100 μM and 150 to 400 μM, respectively, a limit of detection (LOD) of 0.27 μM (at S/N = 3), and good reproducibility, stability, and selectivity. Additionally, we also report an attempt made to propose the modified sensor for the simultaneous detection of dopamine and uric acid (UA). The procedure was also applied for the determination of dopamine in spiked real samples. So, this paper reports for the first time the use of a modified NdFeO₃ screen-printed electrode for developing an electrochemical sensor for the quantification of important biomolecules.

Graphical abstract

     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Synthesis of N(N6)-exocyclic amino acid derivatives of 3-phenylisopropylsydnoneimine

The synthesis of N₆-amino acid derivatives of 3-phenylisopropylsydnoneimine of the carbamoyl and acyl types, which were obtained by the method of polymeric activated esters, is described. The structures of the synthesized compounds were confirmed by their IR and UV spectra.Translated from Khimiya Geterotsiklicheskikh Soedinenii, No. 10, pp. 1335–1339, October, 1978.     

Structure of artabin

Summary FromArtemisia absinthium L. a new sesquiterpene lactone of the germacrane type — artabin — has been isolated. Structure I is proposed for it.Institute of the Chemistry of Plant Substances, Academy of Sciences of the Uzbek SSR. Translated from Khimiya Prirodnykh Soedineii, No. 6, pp. 691–694, November–December, 1970.     

Reaction of allylsilanes and allylstannanes with alkynes catalyzed by electrophilic late transition metal chlorides

The intramolecular reaction of allylsilanes and allylstannanes with alkynes proceeds catalytically in the presence of Pt(II), Pd(II), Ru(II), and Au(III) chlorides. Although more limited, AgOTf also catalyzes the cyclization. Usually, PtCl2 as the catalyst in methanol or acetone gives the best results. The reaction proceeds by exo attack of the allyl nucleophile on the alkyne to form five- or six-membered ring carbocycles. The reaction generally proceeds with anti stereoselectivity. However, a terminally substituted trimethylsilyl derivative reacts by a syn-type addition. The intermediate alkenylpalladium complex has been trapped with allyl chloride to form an allylated derivative with an additional carbon-carbon bond.     

Synthesis of [1,3]dithiole and spiro[1,3]dithiole thiopyran derivatives of the [1,2]dithiolo[1,4]thiazine ring system

We report the synthesis of some new polysulfur-nitrogen heterocycles by cycloaddition reactions to readily available tricyclic condensed 1,2-dithiole-3-thiones. Thus, treatment of bis[1,2]dithiolopyrrole ketothione 1 with diacyl acetylenes gave the bis-aducts 2a-d. On the other hand, cycloaddition of bis[1,2]dithiolo[1,4]thiazine ketothione 3 with 1 equiv of acyl or diacyl acetylenes gave [1,3]dithiolylidenyl[1,2]dithiolo[1,4]thiazines 4a-f in fair to high yields. Catalysis by scandium triflate was used in the reactions that implied the less reactive dipolarophiles. Treatment of 3 with 2 equiv of DBA gave the bis-aduct 5a, and reaction of 4c with DMAD gave the mixed bis-adduct 5b. Cyclic voltammetry of selected examples showed irreversible processes that were influenced by the electrochemical activity of peripheral groups bonded to the heterocyclic system.     

Strong adhesion and smooth conductive surface via graft polymerization of aniline on a modified glass fiber surface

The goal of this paper is to prepare surface-conductive glass fibers. The fibers were first hydroxylated, after which they were reacted with 3-bromopropyltrichlorosilane to form a bromopropylsilane monolayer, which was further reacted with aniline to substitute the bromine atoms. The surface-bound aniline molecules were used as active sites for the graft polymerization of polyaniline (PANI). The composition, structure and the morphology of the modified glass fiber surface were examined by X-ray photoelectron spectroscopy, scanning electron microscopy, and Fourier transform infrared spectroscopy. The method generated a smooth and homogenous thin layer of PANI on the surface of the glass fiber with a surface conductivity of about 6 S/cm, hence larger than the usual value ( approximately 1 S/cm) of the bulk polyaniline.