Metallo‐supramolecular block copolymer micelles: Improved preparation and characterization

Micelles prepared from amphiphilic block copolymers in which a poly(styrene) segment is connected to a poly(ethylene oxide) block via a bis‐(2,2′:6′,2″‐terpyridine‐ruthenium) complex have been intensely studied. In most cases, the micelle populations were found to be strongly heterogeneous in size because of massive micelle/micelle aggregation. In the study reported in this article we tried to improve the homogeneity of the micelle population. The variant preparation procedure developed, which is described here, was used to prepare two “protomer”‐type micelles: PS₂₀‐[Ru]‐PEO₇₀ and PS₂₀‐[Ru]‐PEO₃₇₅. The dropwise addition of water to a solution of the compounds in dimethylformamide was replaced by the controlled addition of water by a syringe pump. The resulting micelles were characterized by sedimentation velocity and sedimentation equilibrium analyses in an analytical ultracentrifuge and by transmission electron microscopy of negatively stained samples. Sedimentation analysis showed virtually unimodal size distributions, in contrast to the findings on micelles prepared previously. PS₂₀‐[Ru]‐PEO₇₀ micelles were found to have an average molar mass of 318,000 g/mol (corresponding to 53 protomers per micelle, which is distinctly less than after micelle preparation by the standard method) and an average hydrodynamic diameter (d_h) of 18 nm. For PS₂₀‐[Ru]‐PEO₃₇₅ micelles, the corresponding values were M = 603,000 g/mol (31 protomers per micelle) and d_h = 34 nm. The latter particles were found to be identical to the “equilibrium” micelles prepared in pure water. Both micelle types had a very narrow molar mass distribution but a much broader distribution of s values and thus of hydrodynamic diameters. This indicates a conformational heterogeneity that is stable on the time scale of sedimentation velocity analysis. The findings from electron microscopy were in disagreement with those from the sedimentation analysis both in average micelle diameter and in the width of the distributions, apparently because of imperfections in the staining procedure. The preparation procedure described also may be useful in micelle formation from other types of protomers. © 2004 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 42: 4458–4465, 2004     

Metallo‐supramolecular micelles: Studies by analytical ultracentrifugation and electron microscopy

In aqueous solutions, amphiphilic block copolymers in which a polystyrene (PS) segment is connected to a poly(ethylene oxide) (PEO) block via a bis(2,2′:6′,2″‐ terpyridine ruthenium) complex can form micelles. Such micelles of the protomer type PS₂₀‐[Ru]‐PEO₇₀, according to the preparation procedure representing frozen micelles, were studied by sedimentation velocity and sedimentation equilibrium analysis in an analytical ultracentrifuge and by transmission electron microscopy, with different techniques applied for the sample preparation. The particles obtained were surprisingly multifarious in size. In ultracentrifugation experiments performed at relatively low salt concentrations, the distributions of the sedimentation coefficient s_20,w showed a pronounced peak at 9.6 S and a broad, only partly separated second peak around 14 S. The molar mass of the particles at the peak was around 430,000 g/mol, corresponding to an aggregation number of approximately 85. The average hydrodynamic diameter of the particles in the peak fraction was approximately 13 nm. In electron micrographs of negatively stained samples, spheres of diameters between 10 and 25 nm were the most abundant particles, but larger ones with a wide size range were also visible. The latter particles apparently were composed of smaller ones. The data from both sedimentation analysis and electron microscopy showed that (1) the studied compound formed primary micelles of diameters around 20 nm and (2) the primary micelles had a tendency toward aggregation. © 2003 Wiley Periodicals, Inc. J Polym Sci Part A: Polym Chem 41: 3159–3168, 2003     

High-resolution four-dimensional 1H-13C NOE spectroscopy using methyl-TROSY, sparse data acquisition, and multidimensional decomposition

An approach for recording four-dimensional (4D) methyl (1)H-(13)C-(13)C-(1)H NOESY spectra with high resolution and sensitivity is presented and applied to Malate Synthase G (723 residues, 82 kDa). Sensitivity and resolution have been optimized using a highly deuterated, methyl-protonated sample in concert with methyl-TROSY, sparse data sampling in the three indirect dimensions, and 4D spectral reconstruction using multidimensional decomposition (MDD). A sparse data acquisition protocol is introduced that ensures that sufficiently long indirect acquisition times can be employed to exploit the decreased relaxation rates associated with methyl-TROSY, without increasing the duration of the 4D experiment beyond acceptable measurement times. In this manner, only a fraction ( approximately 30%) of the experimental data that would normally be needed to achieve a spectrum of high resolution is acquired. The reconstructed 4D spectrum is of similar resolution and sensitivity to three-dimensional (3D) (13)C-edited NOE spectra, is straightforward to analyze, and resolves ambiguities that emerge when 3D data sets only are considered.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Hydrogen abstraction from H‐donor substrates by the 6‐CF3‐benzotriazol‐N‐oxyl radical (TFNO)

The aminoxyl radical 6‐trifluoromethyl‐benzotriazol‐N‐oxyl (TFNO) has been generated from the parent hydroxylamine 6‐CF₃‐1‐hydroxy‐benzotriazole (TFBT) by one‐electron oxidation with a Ce^IV salt and characterized by spectrophotometry and cyclic voltammetry (CV). Rate constants of H‐abstraction (k_H) by TFNO from a number of H‐donor benzylic substrates have been determined spectrophotometrically in MeCN solution at 25 °C. A radical H‐atom transfer (HAT) route of oxidation is substantiated for TFNO by several pieces of evidence. The kinetic data also testify the relevance of stereoelectronic effects upon the HAT reactivity of TFNO. Copyright © 2010 John Wiley & Sons, Ltd.     

Searching for protostars

Summary We present molecular-line observations of young stellar objects (YSOs) suspected to be protostars in the main accretion phase. The aim of this work is to define a list of the best protostellar candidates to be observed in the near future with the ISO spectrometers with the precise scope of searching for the final proof of the infall, theHoly Grail of astrophysics. The sources were mapped in the CS 3?2 and CO 3?2 lines; our data were used to investigate the presence of clumps of materials around these objects and the amount of this material, as well as to detect outflows associated with these objects that would enormously complicate the interpretation of further dynamics studies. Only one of our sources suspected to be protostars resulted to have a good chance of being in the accretion phase and to deserve further spectroscopic measurements. Paper presented at the 6th Cosmic Physics National Conference, Palermo, 3–7 November 1992.     

Entangling macroscopic oscillators exploiting radiation pressure

It is shown that radiation pressure can be profitably used to entangle macroscopic oscillators like movable mirrors, using present technology. We prove a new sufficient criterion for entanglement and show that the achievable entanglement is robust against thermal noise. Its signature can be revealed using common optomechanical readout apparatus.     

A ketogenic diet increases succinic dehydrogenase (SDH) activity and recovers age-related decrease in numeric density of SDH-positive mitochondria in cerebellar Purkinje cells of late-adult rats

Ketogenic diets (KDs) have been applied in the therapy of paediatric epilepsy for nearly a century. Recently, beneficial results have also been reported on metabolic disorders and neurodegeneration, designating aged individuals as possible recipients. However, KDs efficacy decrease after the suckling period, and very little is known about their impact on the aging brain. In the present study, the effect on the neuronal energetic supply of a KD containing 20% of medium chain triglycerides (MCT) was investigated in Purkinje cells of the cerebellar vermis of late-adult (19-month-old) rats. The animals were fed with the KD for 8 weeks, and succinic dehydrogenase (SDH) activity was cytochemically determined. The following parameters of SDH-positive mitochondria were evaluated by the use of a computer-assisted image analysis system connected to a transmission electron microscope: numeric density (Nv), average volume (V), volume density (Vv), and cytochemical precipitate area/mitochondrial area (R). Young, age-matched, and old animals fed with a standard chow were used as controls. We found significantly higher Nv in MCT-KD-fed rats vs. all the control groups, in young vs. late-adult and old controls, and in late-adult vs. old controls. V and Vv showed no significant differences among the groups. R was significantly higher in MCT-KD-fed rats vs. all the control animals, and in old vs. young and late-adult controls. Present data indicate that the ketogenic treatment counteracted age-related decrease in numeric density of SDH-positive mitochondria, and enhanced their metabolic efficiency. Given the central role of mitochondrial impairment in age-related physio-pathological changes of the brain, these findings may represent a starting point to examine novel potentialities for KDs.     

Dissipative effects on internal gravity waves in geophysical fluids

Summary In the present paper we develop a systematic analysis of the dispersion and dissipation effects on internal gravity waves in fluids of geophysical interest. Dissipation induces a cut-off in the short wavelengths, leading to an admissible range of waves. Defining a suitable criterion for detection of waves, an observable wave range results, in which the frequency dispersion is nearly the same as for the inviscid case, whereas the amplitude is damped. The peculiar behaviour displayed by the dispersion relationship for Prandtl number equal to one is discussed.