Sensitivity improvement in 19F NMR-based screening experiments: theoretical considerations and experimental applications

NMR-based binding and functional screening performed with FAXS (fluorine chemical shift anisotropy and exchange for screening) and 3-FABS (three fluorine atoms for biochemical screening) represents a potential alternative approach to high-throughput screening for the identification of novel potential drug candidates. The major limitation of this method in its current status is its intrinsic low sensitivity that limits the number of tested compounds. One approach for overcoming this problem is the use of a cryogenically cooled (19)F probe that reduces the thermal noise in the receiver circuitry. Sensitivity improvement in the two screening techniques achieved with the novel cryogenic (19)F probe technology permits an increased throughput, detection of weaker binders and inhibitors (relevant in a fragment-based lead discovery program), detection of slow binders, and reduction in protein and substrate consumption. These aspects are analyzed with theoretical simulations and experimental quantitative performance evaluation. Application of 3-FABS combined with the cryogenic (19)F probe technology to rapid screening at very low enzyme concentrations and the current detection limits reached with this approach are also presented.     

Influence of inhibitory compounds and minor sugars on xylitol production by <Emphasis Type="Italic">Debaryomyces hansenii</Emphasis>

To obtain in-depth information on the overall metabolic behavior of the new good xylitol producer Debaryomyces hansenii UFV-170, batch bioconversions were carried out using semisynthetic media with compositions simulating those of typical acidic hemicellulose hydrolysates of sugarcane bagasse. For this purpose, we used media containing glucose (4.3–6.5 g/L), xylose (60.1–92.1 g/L), or arabinose (5.9–9.2 g/L), or binary or ternary mixtures of them in either the presence or absence of typical inhibitors of acidic hydrolysates, such as furfural (1.0–5.0 g/L), hydroxymethylfurfural (0.01–0.30 g/L), acetic acid (0.5–3.0 g/L), and vanillin (0.5–3.0 g/L). D. hansenii exhibited a good tolerance to high sugar concentrations as well as to the presence of inhibiting compounds in the fermentation media. It was able to produce xylitol only from xylose, arabitol from arabinose, and no glucitol from glucose. Arabinose metabolization was incomplete, while ethanol was mainly produced from glucose and, to a lesser less extent, from xylose and arabinose. The results suggest potential application of this strain in xyloseto-xylitol bioconversion from complex xylose media from lignocellulosic materials.     

Synthesis and coordination properties of new macrocyclic ligands: equilibrium studies and crystal structures

The synthesis and characterization of two new macrocyclic ligands, the bis-macrocyclic compound 2,6-bis(1,4,13-triaza-7,10-dioxacyclopentadec-1-ylmethyl)phenol (L) and 38-methoxy-1,4,13,16,19,28-hexaaza-7,10,22,25-tetraoxatricyclo[14.14.7.1(32,36)]octatriconta-32,34,Delta(36,38)-triene (L1) are reported. Equilibrium studies of basicity and coordination properties toward metal ions such as Cu(II), Zn(II), Cd(II) and Pb(II) were performed for ligand by potentiometric measurements in aqueous solution (298.1 +/- 0.1 K, I= 0.15 mol dm(-3)). L behaves as a hexaprotic base (logK(1)= 10.93, logK(2)= 9.70, logK(3)= 8.79, logK(4)= 8.05, logK(5)= 6.83, logK(6)= 2.55). All metal ions form stable mono- and dinuclear complexes: logK(MLH(-1))= 25.61 for Cu(II), 15.37 for Zn(II), 12.58 for Cd(II) and 13.79 for Pb(II); logK(M(2)LH(-1))= 31.61 for Cu(II), 23.38 for Zn(II), 24.49 for Cd(II) and 23.68 for Pb(II). All these dinuclear species show a great tendency to add the OH(-) group: the equilibrium constant for the addition reaction was found to be logK(M(2)LH(-1)OH)= 4.77 for Cu(II), 5.66 for Zn(II), 2.8 for Cd(II) and 3.18 for Pb(II). In the case of Ni(II), kinetic inertness prevents the possibility of solution studies. The dinuclear solid adducts [Ni(2)H(-1)L(N(3))(3)].EtOH and [Cu(2)H(-1)L(N(3))](ClO(4))(2) were characterized by X-ray analysis.     

alpha-(Arylthio)imidoyl Radicals: [3 + 2] Radical Annulation of Aryl Isothiocyanates with 2-Cyano-Substituted Aryl Radicals

A novel cascade radical reaction is described involving aryl isothiocyanates and 2-cyanoaryl radicals. The mechanism entails the formation of an alpha-(arylthio)imidoyl radical, a 5-exo-dig cyclization onto a cyano group, and a final 6-membered ring closure of an iminyl radical. The competitive 5-membered spiro-cyclization of the iminyl, leading to an isomeric product, was only observed in the case of a disubstituted aryl isothiocyanate. The whole process involves a rare example of [3 + 2] radical annulation and allows the one-pot synthesis of tetracondensed nitrogen heterocycles in good yields.     

A longitudinal study of MR diffusion changes in normal appearing white matter of patients with early multiple sclerosis

BACKGROUND AND PURPOSE: The stage at which normal appearing white matter (NAWM) abnormalities first appear in multiple sclerosis (MS) is not clear. The aim of our study was to monitor water diffusion changes over time in NAWM of patients with early MS.METHODS: Out of a consecutive series of patients enrolled in a MR study on clinically isolated syndrome (CIS), we selected 19 subjects who had completed a one year follow-up. The MR scans obtained at baseline and at 12 months were reviewed according to the new criteria on the diagnosis of MS. Lesion load on T2 and T1 weighted images and the trace of the apparent diffusion coefficient in NAWM were measured both at baseline and at 12 months in patients and in 12 healthy controls.RESULTS: In three patients the diagnosis of MS was done at baseline based on MR. Thirteen patients developed MS during the study and in three patients the diagnosis remained "possible MS." TADC in NAWM in patients was significantly higher than in controls at the 12 months' follow-up but not at baseline (controls mean tADC +/- sd = 0.745 +/- 0.02 mm(2)/sec x 10(-3); patients mean tADC(12) +/- sd = 0.767 +/- 0.02 mm(2)/sec x 10(-3); p < 0.02). TADC and T2 lesion load at 12 months were significantly correlated (p < 0.01). Patients exhibiting tADC(12) above a confidence interval had a significantly greater EDSS score at the same time period (EDSS(12) +/- sd = 1.9 +/- 0.5 and = 1.1 +/- 0.4 respectively; p < 0.01).CONCLUSIONS: This study suggests that diffusion MR cannot detect alterations in NAWM of patients with a CIS suggestive of MS. After one year, when most patients develop MS, diffusion MR abnormalities in NAWM become apparent. These abnormalities are correlated with T2 lesion load and may contribute to neurological impairment.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

New artificial receptors from selectively functionalized calix[4]arenes

Abstract

The development of new synthetic methods for the monoalkylation of calix[4]arenes at the lower rim allows the synthesis of a new class of trihydroxamate siderophores. Three chelating hydroxamic acid units are introduced through a sequence of reactions which blocks the macrocycle in the cone conformation. The new ligands obtained form neutral 1:1 complexes (FeL) with iron (III), which are stable in EtOH/H₂O 9:1 at pH 2–7. Calix[4]arene bis-crown ethers are prepared by exploiting the selective 1,2-(proximal) functionalization of calix[4]arenes at the lower rim. These ligands are, however, less effective in complexing alkali metal cations compared with the 1,3-calix[4]arene crown-ethers which, in their partial cone structure, offer a better shielding for the complexed cations. Rigid upper rim-bridged calix[4]arenes potentially useful for the inclusion of neutral molecules are prepared by exploiting the selective 1,3-diformylation of calix[4]arene at the upper rim. Finally a new chloromethylation method for calix[4]arenes blocked in the cone conformation is described together with the synthesis of new cavitands.     

Quantitative fingerprinting by headspace—Two-dimensional comprehensive gas chromatography–mass spectrometry of solid matrices: Some challenging aspects of the exhaustive assessment of food volatiles

The study proposes an investigation strategy that simultaneously provides detailed profiling and quantitative fingerprinting of food volatiles, through a “comprehensive” analytical platform that includes sample preparation by Headspace Solid Phase Microextraction (HS-SPME), separation by two-dimensional comprehensive gas chromatography coupled with mass spectrometry detection (GC × GC–MS) and data processing using advanced fingerprinting approaches.