GO-SWCNT Buckypapers as an Enhanced Technology for Water Decontamination from Lead

Water decontamination is an important challenge resulting from the incorrect disposal of heavy metal waste into the environment. Among the different available techniques (e.g., filtration, coagulation, precipitation, and ion-exchange), adsorption is considered the cheapest and most effective procedure for the removal of water pollutants. In the last years, several materials have been tested for the removal of heavy metals from water, including metal-organic frameworks (MOFs), single-walled carbon nanotubes (SWCNTs), and graphene oxide (GO). Nevertheless, their powder consistency, which makes the recovery and reuse after adsorption difficult, is the main drawback for these materials. More recently, SWCNT buckypapers (SWCNT BPs) have been proposed as self-standing porous membranes for filtration and adsorption processes. In this paper, the adsorption capacity and selectivity of Pb²⁺ (both from neat solutions and in the presence of other interferents) by SWCNT BPs were evaluated as a function of the increasing amount of GO used in their preparation (GO-SWCNT buckypapers). The highest adsorption capacity, 479 ± 25 mg g⁻¹, achieved for GO-SWCNT buckypapers with 75 wt.% of graphene oxide confirmed the effective application of such materials for cheap and fast water decontamination from lead.     

Low n-6/n-3 Gestation and Lactation Diets Influence Early Performance,Muscle and Adipose Polyunsaturated Fatty Acid Content and Deposition,and Relative Abundance of Proteins in Suckling Piglets

Elevated omega-6 (n-6) and omega-3 (n-3) polyunsaturated fatty acids (PUFAs) ratios in swine diets can potentially impose a higher risk of inflammatory and metabolic diseases in swine. A low ratio between the two omega PUFAs has beneficial effects on sows’ and piglets’ production performance and immunity status. At present, there are few studies on how sow nutrition directly affects the protein and fat deposition in suckling piglets. Two groups of sows were fed diets with high or low n-6/n-3 polyunsaturated ratios of 13:1 (SOY) and 4:1 (LIN), respectively, during gestation and lactation. Longissimus dorsi muscle and adipose tissue from newborn piglets, nourished only with sow’s milk, were subjected to fatty acid profiling by gas chromatography–mass spectrometry (GC-MS) and to proteomics assays based on nano-liquid chromatography coupled to high-resolution tandem mass spectrometry (nLC-HRMS). Fatty acid profiles on both muscle and adipose tissues resembled the magnitude of the differences between fatty acid across diets. Proteomic analysis revealed overabundance of 4 muscle and 11 adipose tissue proteins in SOY compared to LIN in both piglet tissues. The detected overabundance of haptoglobin, an acute-phase protein, and the stimulation of protein-coding genes and proteins related to the innate immune response and acute inflammatory response could be associated with the pro-inflammatory role of n-6 PUFAs.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Fluid Flows Around Floating Bodies, I: The Hydrostatic Case

We consider the hydrostatic configuration of a body floating freely on a liquid. Under the influence of gravitational and capillary forces there exists an equilibrium solution with contact angle π/2. This solution is the minimizer of a variational problem with an obstacle condition; the corresponding free boundary consists of the curve where the capillary surface meets the floating body.     

The Thermodynamics of Translesion DNA Synthesis Past Major Adducts of Enantiomeric Analogues of Antitumor Cisplatin

The Pt^II-coordination complex [PtCl₂(DAB)] (DAB=2,3-diaminobutane) belongs to a class of cytotoxic cisplatin analogues that contain chiral diamine ligands. Enantiomeric pairs of these compounds have attracted particular interest because they have different effects on different DNA conformations, which, in turn, influences the binding of damaged-DNA-processing enzymes that control downstream effects of the adducts, and thus exhibit different biological activities of the enantiomers. Herein, we studied the translesion synthesis across the major 1,2-d(GG) intrastrand cross-link formed by the R,R and S,S enantiomers of [Pt(DAB)]²⁺ in the TGGT sequence by using the enzyme that catalyzes the polymerization of deoxyribonucleotides into a DNA strand. We also employed differential scanning calorimetry (DSC) to measure the thermodynamic changes associated with replication-bypass past 1,2-d(GG) adducts of the [Pt(DAB)]²⁺ enantiomers. In the sequence TGGT, the 1,2-d(GG) intrastrand cross-links that were formed by the enantiomeric pairs of [Pt(DAB)]²⁺ inhibited DNA polymerization in a chirality-dependent manner. The thermodynamic data helped to understand the effect of the alterations in thermodynamic stability of DNA caused by the Pt-d(GG) adducts upon DNA polymerization across these lesions. Moreover, these data can possibly explain the influence of these alterations on the ability of many DNA polymerases to bypass adducts of antitumor platinum drugs. These results also highlighted the usefulness of DSC in evaluating the impact of DNA adducts of platinum-coordinated compounds on the processing of these lesions by damaged-DNA processing-enzymes.     

Numerical simulation of a double-gate MOSFET with a subband model for semiconductors based on the maximum entropy principle

A nanoscale double-gate MOSFET is simulated with an energy-transport subband model for semiconductors formulated starting from the moment system derived from the Schr?dinger–Poisson–Boltzmann equations. The system is closed on the basis of the maximum entropy principle and includes scattering of electrons with acoustic and non-polar optical phonons. The proposed expression of the entropy combines quantum effects and semiclassical transport by weighting the contribution of each subband with the square modulus of the envelope functions arising from the Schr?dinger–Poisson subsystem. The simulations show that the model is able to capture the relevant confining and transport features and assess the robustness of the numerical scheme.     

Modeling Transverse Relative Locality

We investigate some aspects of relativistic classical theories with “relative locality”, in which pairs of events established to be coincident by nearby observers may be described as non-coincident by distant observers. While previous studies focused mainly on the case of longitudinal relative locality, where the effect occurs along the direction connecting the distant observer to the events, we here focus on transverse relative locality, in which instead the effect is found in a direction orthogonal to the one connecting the distant observer to the events. Our findings suggest that, at least for theories of free particles, transverse relative locality is as significant as longitudinal relative locality both conceptually and quantitatively. And we observe that “dual gravity lensing” can be viewed as one of two components of transverse relative locality. We also speculate about a type of spacetime noncommutativity for which transverse relative locality could be particularly significant.