A simple stereocontrolled synthesis of salinosporamide A

A simple and effective stereocontrolled synthesis of salinosporamide A has been developed. This process, the first synthesis of salinosporamide A, is capable of providing the compound in substantial quantities for further biological studies. Salinosporamide A was of special interest as a synthetic target because of its potent in vitro cytotoxic activity against many tumor cell lines (IC(50) values of 10 nM or less).     

Ciprofloxacin-protected gold nanoparticles

The antibacterial drug ciprofloxacin (cfH) has been used to protect gold nanoparticles of two different mean diameters, 4 and 20 nm. The protection is complete with about 65 and 585 cfH molecules covering 4 and 15 nm particles, respectively. The nature of binding has been investigated by several analytical techniques. The nitrogen atom of the NH moiety of piperazine group binds on the gold surface, as revealed by voltammetric and spectroscopic studies. The cfH-adsorbed particles are stable in the dry state as well as at room temperature, and as a result, redispersion is possible. The rate of release of the drug molecule from the nanoparticles is more in the basic medium than in pure water, and the kinetics depend on the size of the particle; faster desorption is seen in smaller particles. The bound cfH is fluorescent, and this property could be used in biological investigations. This study shows that metal nanoparticles could be useful carriers for cfH and fluoroquinolone molecules. Most of the bound molecules could be released over an extended period of time.     

Asymmetric allylboration of alpha,beta-enals as a surrogate for the enantioselective synthesis of allylic amines and alpha-amino acids

[reaction: see text] Optically pure allylic amines have been synthesized from alpha,beta-unsaturated aldehydes via allylboration with (-)-B-allyldiisopinocampheylborane, followed by Overman rearrangement. By incorporating crotyl and alkoxyallylboration, functionalization at delta-position was readily accomplished. By applying this methodology, the synthesis of several chiral alpha-amino acids has been achieved.     

Stereoselective synthesis of (3R,4S,5S,9S)-3,5,9-trihydroxy-4-methylundecanoic acid δ-lactone

A stereoselective synthesis of the pentaketide lactone (3R,4S,5S,9S)-3,5,9-trihydroxy-4-methylundecanoic acid δ-lactone has been achieved.     

9,9‐Dimethoxy‐7,11‐diphenyl‐2,4‐diazaspiro[5.5]undecane‐1,3,5‐trione monohydrate

Due to steric repulsions, the cyclo­hexane ring in the title compound, C₂₃H₂₄N₂O₅·H₂O, shows some bond‐length abnormalities and adopts a chair conformation. The pyrimidine and cyclo­hexane rings are approximately perpendicular to each other, and the phenyl rings are equatorial. C—H?π and N—H?O intermolecular interactions, as well as C—H?O inter‐ and intramolecular interactions, occur between the mol­ecules. In addition to van der Waals interactions, the water mol­ecule interacts with the pyrimidine­trione ring to stabilize the structure.     

LiBF4-Catalyzed three-component coupling of an aldehyde, acetic anhydride and allyltrimethylsilane/TMSCN

Lithium tetrafluoroborate is found to be an efficient catalyst for allylation and cyanation of aldehydes with allyltrimethylsilane and trimethylsilyl cyanide in the presence of acetic anhydride at room temperature to produce homoallylic acetates and α-cyano acetates in excellent yields. A solution of 10 mol % of LiBF₄ in acetonitrile provides a convenient reaction medium to carry out allylation and cyanation reactions under very mild and neutral conditions.     

Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding

Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.     

Intramolecular nucleophilic activation promoting efficient hydrolytic cleavage of DNA by (aqua)bis(dipyridoquinoxaline)copper(II) complex

The axial aqua bound copper(II) complex [Cu(dpq)2(H2O)](ClO4)2, having a planar NN-donor heterocyclic base dipyridoquinoxaline (dpq) as the DNA minor groove binder, shows efficient hydrolytic cleavage of supercoiled DNA in the dark and in the absence of any external reagents, as evidenced from T4 ligase experiments, with a rate of 5.58 +/- 0.4 h(-1) and a rate enhancement of 1.55 x 10(8).     

Synthesis and spectral studies of novel copper(II) chelates of sulphur-containing oximes

Summary Copper complexes of benzil--monoxime-2-iminoethanethiol (BMETH₂), benzil--monoxime-2-iminobenzenethiol (BMBTH₂), benzil--monoximethiosemicarbazone (BMTH₂) and benzil--monoximesemicarbazone (BMSH₂) were synthesized and characterized by physicochemical and spectroscopic measurements. The molar conductivities show that all of the complexes are nonelectrolytes. The i.r. spectra suggest that the ligands are tetradentate in all cases, whilst the electronic spectra suggest planar geometries for all the complexes. The calculated e.s.r. parameters show an axial dx ² - y ² ground state and suggest coordination through sulphur, in agreement with the i.r. results. In all of these complexes, the =N—;O group acts as a bridging function to give dimeric structures.     

Novel Synthesis of Mafenide and Other Amino Sulfonamides by Electrochemical Reduction of Cyano Sulfonamides

Both aliphatic and aromatic amino sulfonamides such as mafenide ( 1a ) were synthesized in good yields (80–86%) by direct electrochemical hydrogenation of the corresponding nitriles in an undivided cell containing a Ni cathode, a Pt anode, and Raney Ni as catalyst (Table 1). The reaction can be performed without external supply of pressurized gas by in situ generation of H₂. Slightly elevated temperatures (45°) and low current densities (10 mA/cm²) are favorable conditions for this type of electrochemical nitrile hydrogenation. Our synthetic protocol does not require high‐pressure equipment or chemical hazards, is environmentally very friendly, and more economical than traditional methods. The concentration of adsorbed H^. radicals on the catalyst surface can be easily controlled by adjusting the electric potential, which may lead to improved product selectivity and, at the same time, reduces the risk of explosion and fire.