Algebraic models of smooth manifolds

Research supported by the NSF Grant DMS-8602672     

Lattices contained in planar orders are planar

The covering graph of a lattice which is contained in an ordered set with a planar covering graph is itself planar.Presented by R. W. Quackenbush.     

Paraxial designing of planar waveguide variable-index focusing elements: Part 2—lenses of elliptical symmetry

A paraxial ray-optics formalism proposed for designing radially symmetric variable-index lenses is extended to the case of lenses of elliptical symmetry of the index profile.     

The localization of energy in gauge field theories and in linear gravitation

It is shown how the energy-positivity criterion enables us to localize the energy in various field theories. For this purpose the role of surface integrals in a canonical formalism is investigated. The same techniques are applied to linearized gravity, where the mixed Cauchy-boundary value problem in a finite volume is analyzed. Unconstrained degrees of freedom and boundary data which have to be controlled are found. This paper is part of a program to analyze the possibility of localization of gravitational energy in complete General Relativity.     

Global existence inL 1 for the modified nonlinear Enskog equation in ℝ3

A global existence theorem with large initial data inL ¹ is given for the modified Enskog equation in ³. The method, which is based on the existence of a Liapunov functional (analog of theH-Boltzmann theorem), utilizes a weak compactness argument inL ¹ in a similar way to the DiPerna-Lions proof for the Boltzmann equation. The existence theorem is obtained under certain condition on the behavior of the geometric factorY. The condition onY amounts to the fact that theL ¹ norm of the collision term grows linearly when the local density tends to infinity.     

A model of adsorption at liquid-solid interface involving association in the bulk phase

A model of monolayer adsorption of binary liquid mixtures on homogeneous and heterogeneous solid surfaces involving association of one component in the bulk phase is discussed. Suitable model calculations, illustrating association and heterogeneity effects, have been performed according to an equation derived for adsorption excess. This equation has been examined by using the experimental data of adsorption of alcohols from benzene andn-heptane on silica gel.

---

Adsorptionsmodell für die Grenzfläche Feststoff-Flüssigkeit unter Berücksichtigung der Assoziation in der Flüssigkeitsphase

Zusammenfassung Es wird ein Adsorptionsmodell binärer, flüssiger Mischungen an homogenen und heterogenen Oberflächen von Feststoffen unter Beachtung der Assoziation eines der Bestandteile in der Flüssigkeitsphase diskutiert. Mit der aus dem Oberflächenüberschuß abgeleiteten Gleichung wurden entsprechende Modellberechnungen durchgeführt, die die mit Assoziation und Heterogenität verbundenen Effekte illustrieren. Die Gleichung wurde für die experimentellen Daten der Alkoholadsorption aus Benzol undn-Heptan an Kieselgel überprüft.

     

Sufficient conditions for a strong relative minimum in an optimal control problem

In this paper, on the basis of Young's method (Ref. 1), sufficient conditions for a strong relative minimum in an optimal control problem are given. Young's method generalizes geodesic coverings and the simplest Hilbert integral from the standard variational calculus. This paper carries Young's method over to nonparametric problems.     

Intra- and intermolecular fluorescence quenching in 7-(pyridyl)indoles

Three isomeric 7-(pyridyl)indoles reveal very different, solvent-dependent photophysical properties. Due to rapid excited state depopulation involving intramolecular hydrogen bonding, 7-(2′-pyridyl)indole is practically nonfluorescent at room temperature. In nonpolar and polar aprotic solvents, 7-(3′-pyridyl)indole and 7-(4′-pyridyl)indole fluorescence strongly, but the emission is quenched in alcohols. Syn and anti rotameric forms of 7-(3′-pyridyl)indole are detected, each quenched to a different degree. This differential quenching is interpreted as evidence of enhanced S₁ → S₀ internal conversion being more efficient in cyclic solvates, with alcohol molecules forming a bridge between the proton donor and acceptor groups of an excited chromophore.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.