A novel general route for the preparation of enantiopure imidazolines

A novel procedure for the preparation of enantiopure 1,4-disubstituted 2-imidazolines is reported. Enantiopure beta-amino alcohols are converted into N-hydroxyethylamides, which are reacted with excess thionyl chloride, or with thionyl chloride followed by phosphorus pentachloride to yield N-chloroethylimidoyl chlorides. These intermediates are treated with amines and anilines to produce N-chloroethylamidines, which are converted into imidazolines upon workup with aqueous hydroxide. The method is simple and efficient and has been used to prepare a wide variety of enantiopure imidazolines, in a modular fashion, from readily available amino alcohols.     

New far infrared laser lines from 13CH2F2 and frequency measurements

We report new FIR laser lines from ¹³CH₂F₂ molecules optically pumped by a waveguide CO₂ laser. The increased tunability (300 MHz) with respect to a conventional CO₂ laser allows the pumping of ¹³CH₂F₂ vibrational transitions of large offset. 34 new laser lines have been discovered, ranging from 113.1 m to 491.4 m in wavelength, thus increasing the number of known FIR laser lines from this important molecule to 99. For all the new lines and many (36) of those known previously, precise offset measurements through the transferred Lamb-dip technique were performed. The frequency of six new laser lines was also directly measured by heterodyne detection with known laser lines.     

High performance liquid chromatography assay for alanine amino transferase

Summary An improved method of alanine-amino transferase determination is proposed. The reaction is carried out with alanine and 2-oxoglutarate as substrates and analysis is by HPLC on a reversed-phase chromatographic system using a C₁₈ column and tetrabutylammonium phosphate in phosphate buffer (pH 7.0)-acetonitrile as mobile phase. The enzyme activity was determined by directly following the formation of pyruvic acid without employing any secondary reaction, which is necessary in the spectrophotometric method. The detection limit of pyruvic acid is 10 pmole l^–1 and the standard deviation for the enzymatic activity of standard solutions is 5.4%. Furthermore under the chromatographic conditions selected it is possible to detect the presence of some intermediate species.Work supported by National Research Council of Italy. Presented in part at the First International Symposium on Applications of HPLC in Enzyme Chemistry, Verona, September 1990.     

Hydrogen-bonded networks in ethanol proton wires: IR spectra of (EtOH)qH+-Ln clusters (L = Ar/N2, q < or = 4, n < or = 5)

Isolated and microsolvated protonated ethanol clusters, (EtOH)qH+-Ln with L = Ar and N2, are characterized by infrared photodissociation (IRPD) spectroscopy in the 3 microm range and quantum chemical calculations. For comparison, also the spectrum of the protonated methanol dimer, (MeOH)2H+, is presented. The IRPD spectra carry the signature of H-bonded (EtOH)qH+ chain structures, in which the excess proton is either strongly localized on one or (nearly) equally shared between two EtOH molecules, corresponding to Eigen-type ion cores (EtOH2+ for q = 1, 3) or Zundel-type ion cores (EtOH-H+-HOEt for q = 2, 4), respectively. In contrast to neutral (EtOH)q clusters, no cyclic (EtOH)qH+ isomers are detected in the size range investigated (q < or = 4), indicative of the substantial impact of the excess proton on the properties of the H-bonded ethanol network. The acidity of the two terminal OH groups in the (EtOH)qH+ chains decreases with the length of the chain (q). Comparison between (ROH)qH+ with R = CH3 and C2H5 shows that the acidity of the terminal O-H groups increases with the length of the aliphatic rest (R). The most stable (EtOH)qH+-Ln clusters with n < or = 2 feature intermolecular H-bonds between the inert ligands and the two available terminal OH groups of the (EtOH)qH+ chain. Asymmetric microsolvation of (EtOH)qH+ with q = 2 and 4 promotes a switch from Zundel-type to Eigen-type cores, demonstrating that the fundamental structural motif of the (EtOH)qH+ proton wire sensitively depends on the environment. The strength of the H-bonds between L and (EtOH)qH+ is shown to provide a rather sensitive probe of the acidity of the terminal OH groups.     

A complete family of isostructural cluster compounds with cubane-like M(3)S(4)M' cores (M = Mo,W; M' = Ni,Pd, Pt): comparative crystallography and electrochemistry

By reaction of the geometrically incomplete cubane-like clusters [(eta(5)-Cp')(3)Mo(3)S(4))][pts] and [(eta(5)-Cp')(3)W(3)S(4)][pts] (Cp' = methylcyclopentadienyl; pts = p-toluenesulfonate) with group 10 alkene complexes, three new heterobimetallic clusters with cubane-like cluster cores were isolated: [(eta(5)-Cp')(3)W(3)S(4)M'(PPh(3))][pts] ([5][pts], M' = Pd; [6][pts], M' = Pt); [(eta(5)-Cp')(3)Mo(3)S(4)Ni(AsPh(3))][pts] ([7][pts]). The compounds [5][pts]-[7][pts] are completing the extensive series of clusters [(eta(5)-Cp')(3)M(3)S(4)M'(EPh(3))][pts] (M = Mo, W; M' = Ni, Pd, Pt; E = P, As) which allows the consequences of replacing a single type of atom on structural and NMR and UV/vis spectroscopic as well as electrochemical properties to be determined. Single-crystal X-ray structure determinations of [5][pts]-[7][pts] revealed that [5][pts] was not isomorphous to the other members of the series [(eta(5)-Cp')(3)M(3)S(4)M'(EPh(3))][pts] due to distinctly different cell parameters, which in the molecular structure of [5](+) is reflected in a slightly different orientation of the PPh(3) ligand. Electrochemical measurements on the series showed that the Mo-based clusters were more difficult to oxidize than their W-based analogues. The Pd-containing clusters underwent two-electron oxidation processes, whereas the Ni- and Pt-containing clusters underwent two separated one-electron oxidation processes.     

A scale value for the balance inside a historical opera house

In the framework of opera house acoustics, the term "balance" refers to the acoustical competition between the singer on the stage and the orchestra in the pit. The mechanism allowing the operatic singers to be heard over the orchestra has to do with their skill in enhancing the vocal emission by a peculiar use of the formant frequencies. This vital factor is sensed by the listeners and, apart from the obvious sound power ratio of the stage and the pit sources, is the main cue that helps to formulate a subjective impression of the balance. To achieve its objective qualification, two calibrated sound sources can be placed on the stage and in the pit, respectively, and their sound level difference is measured at the listeners' seats. The scope of this work is to investigate the relationship between the subjective impression and the objective indicator of the balance and to develop a scale value for the parameter in the case of a historical opera house. For this scope a set of acoustical data from the Teatro Comunale in Ferrara will be used to create synthetic sound fields with controlled conditions of the balance between the stage and the pit. This methodology employs an anechoic piece for soprano (with piano accompaniment) and is implemented in a dead room equipped with an acoustical rendering system. The sound fields are used to investigate the appropriate balance values by means of listening tests. The results of the scaling exercise show that a suitable range of values can be extracted and that the sound from the stage and the pit is perceived as balanced when the loudness difference between the two is comprised within -2.0 dBA and +2.3 dBA.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Pseudopeptide‐Based Hydrogels Trapping Methylene Blue and Eosin Y

We present herein the preparation of four different hydrogels based on the pseudopeptide gelator Fmoc‐l ‐Phe‐d ‐Oxd‐OH (Fmoc=fluorenylmethyloxycarbonyl), either by changing the gelator concentration or adding graphene oxide (GO) to the water solution. The hydrogels have been analysed by rheological studies that demonstrated that pure hydrogels are slightly stronger compared to GO‐loaded hydrogels. Then the hydrogels efficiency to trap the cationic methylene blue (MB) and anionic eosin Y (EY) dyes has been analyzed. MB is efficiently trapped by both the pure hydrogel and the GO‐loaded hydrogel through π–π interactions and electrostatic interactions. In contrast, the removal of the anionic EY is achieved in less satisfactory yields, due to the unfavourable electrostatic interactions between the dye, the gelator and GO.