A complete family of isostructural cluster compounds with cubane-like M(3)S(4)M' cores (M = Mo,W; M' = Ni,Pd, Pt): comparative crystallography and electrochemistry

By reaction of the geometrically incomplete cubane-like clusters [(eta(5)-Cp')(3)Mo(3)S(4))][pts] and [(eta(5)-Cp')(3)W(3)S(4)][pts] (Cp' = methylcyclopentadienyl; pts = p-toluenesulfonate) with group 10 alkene complexes, three new heterobimetallic clusters with cubane-like cluster cores were isolated: [(eta(5)-Cp')(3)W(3)S(4)M'(PPh(3))][pts] ([5][pts], M' = Pd; [6][pts], M' = Pt); [(eta(5)-Cp')(3)Mo(3)S(4)Ni(AsPh(3))][pts] ([7][pts]). The compounds [5][pts]-[7][pts] are completing the extensive series of clusters [(eta(5)-Cp')(3)M(3)S(4)M'(EPh(3))][pts] (M = Mo, W; M' = Ni, Pd, Pt; E = P, As) which allows the consequences of replacing a single type of atom on structural and NMR and UV/vis spectroscopic as well as electrochemical properties to be determined. Single-crystal X-ray structure determinations of [5][pts]-[7][pts] revealed that [5][pts] was not isomorphous to the other members of the series [(eta(5)-Cp')(3)M(3)S(4)M'(EPh(3))][pts] due to distinctly different cell parameters, which in the molecular structure of [5](+) is reflected in a slightly different orientation of the PPh(3) ligand. Electrochemical measurements on the series showed that the Mo-based clusters were more difficult to oxidize than their W-based analogues. The Pd-containing clusters underwent two-electron oxidation processes, whereas the Ni- and Pt-containing clusters underwent two separated one-electron oxidation processes.     

Tailoring the optical and magnetic properties of La-BaM hexaferrites by Ni substitution

We investigate the impact of Ni insertion on the structural,optical,and magnetic properties of Ba_0.8La_0.2Fe_12-xNi_xO₁₉hexaferrites(Ni substituted La-BaM hexaferrites).Samples were prepared using the conventional co-precipitation method and sintered at 1000℃for 4 hours to assist the crystallization process.An analysis of the structure of the samples was carried out using an x-ray diffraction(XRD)spectrometer.The M-type hexagonal structure of all the samples was confirmed using XRD spectra.The lattice parameters a and c were found to be in the ranges of 5.8925±0.001 nm–5.8952±0.001 nm and 23.2123±0.001 nm–23.2219±0.001 nm,respectively.The M-type hexagonal nature of the prepared samples was also indicated by the presence of corresponding FT-IR bands and Raman modes in the FT-IR and Raman spectra,respectively.EDX results confirmed the successful synthesis of the samples according to the required stoichiometric ratio.A UV-vis spectrometer was used to record the absorption spectra of the prepared samples in the wavelength range of 200 nm–1100 nm.The optical energy bandgap of the samples was found to be in the range of 1.21 eV–3.39 eV.The M–H loops of the samples were measured at room temperature at an applied magnetic field range of 0 kOe–60 kOe.A high saturation magnetization of 99.92 emu/g was recorded in the sample with x=0 at a microwave operating frequency of 22.2 GHz.This high value of saturation magnetization is due to the substitution of La3+ions at the spin-up(12k,2a,and 2b)sites.The Ni substitution is proven to be a potential candidate for the tuning of the optical and magnetic parameters of M-type hexaferrites.Therefore,we suggest that the prepared samples are suitable for use in magneto-optic applications.     

A scale value for the balance inside a historical opera house

In the framework of opera house acoustics, the term "balance" refers to the acoustical competition between the singer on the stage and the orchestra in the pit. The mechanism allowing the operatic singers to be heard over the orchestra has to do with their skill in enhancing the vocal emission by a peculiar use of the formant frequencies. This vital factor is sensed by the listeners and, apart from the obvious sound power ratio of the stage and the pit sources, is the main cue that helps to formulate a subjective impression of the balance. To achieve its objective qualification, two calibrated sound sources can be placed on the stage and in the pit, respectively, and their sound level difference is measured at the listeners' seats. The scope of this work is to investigate the relationship between the subjective impression and the objective indicator of the balance and to develop a scale value for the parameter in the case of a historical opera house. For this scope a set of acoustical data from the Teatro Comunale in Ferrara will be used to create synthetic sound fields with controlled conditions of the balance between the stage and the pit. This methodology employs an anechoic piece for soprano (with piano accompaniment) and is implemented in a dead room equipped with an acoustical rendering system. The sound fields are used to investigate the appropriate balance values by means of listening tests. The results of the scaling exercise show that a suitable range of values can be extracted and that the sound from the stage and the pit is perceived as balanced when the loudness difference between the two is comprised within -2.0 dBA and +2.3 dBA.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

OPTIMAL MAPS IN NON BRANCHING SPACES WITH RICCI CURVATURE BOUNDED FROM BELOW

We prove existence of optimal maps in non branching spaces with Ricci curvature bounded from below. The approach we adopt makes no use of Kantorovich potentials.     

Pseudopeptide‐Based Hydrogels Trapping Methylene Blue and Eosin Y

We present herein the preparation of four different hydrogels based on the pseudopeptide gelator Fmoc‐l ‐Phe‐d ‐Oxd‐OH (Fmoc=fluorenylmethyloxycarbonyl), either by changing the gelator concentration or adding graphene oxide (GO) to the water solution. The hydrogels have been analysed by rheological studies that demonstrated that pure hydrogels are slightly stronger compared to GO‐loaded hydrogels. Then the hydrogels efficiency to trap the cationic methylene blue (MB) and anionic eosin Y (EY) dyes has been analyzed. MB is efficiently trapped by both the pure hydrogel and the GO‐loaded hydrogel through π–π interactions and electrostatic interactions. In contrast, the removal of the anionic EY is achieved in less satisfactory yields, due to the unfavourable electrostatic interactions between the dye, the gelator and GO.