Measurement of hypoiodous acid concentration by a novel type iodide selective electrode and a new method to prepare HOI. Monitoring HOI levels in the Briggs-Rauscher oscillatory reaction

A new type of iodide selective electrode prepared by dipping a silver wire into molten silver iodide is reported. The electrode was calibrated for silver and iodide ions and the measured electromotive force for various Ag(+) and I(-) concentrations was close to the theoretical within a few millivolts. Besides Ag(+) and I(-) ions, however, the electrode also responds to hypoiodous acid. Thus, the electrode was calibrated for HOI as well, and for that purpose a new method of hypoiodous acid preparation was developed. To explain the close to Nernstian electrode response for HOI and also the effect of hydrogen ion and iodine concentration on that response, the corrosion potential theory suggested earlier by Noszticzius et al. was modified and developed further. Following oscillations in the Briggs-Rauscher reaction with the new electrode the potential crosses the "solubility limit potential" (SLP) of silver iodide. Potentials below SLP are controlled by the concentration of I(-), but potentials above SLP are corrosion potentials determined by the concentration of HOI. Finally, the measured HOI oscillations are compared with calculated ones simulated by a model by Furrow et al.     

Surface‐enhanced Raman spectroscopy of genomic DNA from in vitro grown plant species

Surface‐enhanced Raman scattering (SERS) effect was used to demonstrate ultrasensitive optical detection of nucleic acids. In this work, the SERS spectra of seven genomic DNAs from leaves of Arnica montana (L.), Fam. Compositae, Astragalus peterfii (Jáv.), Fam. Fabaceae, Kalanchoe x hybrida, Fam. Crassulaceae, strawberry (Fragaria x ananassa Duch.), Fam. Rosaceae, carnation (Dianthus caryophyllus L.), Fam. Caryophyllaceae, apple (Malus domestica Borkh.), Fam. Rosaceae and Persian violet (Exacum affine Balf.), Fam. Gentianaceae were analyzed in the wavenumber range 200–1800 cm⁻¹. SERS signatures, spectroscopic band assignments and structural interpretations of these plant genomic DNAs are reported. SERS spectra of nucleic acids are compared here with caution, because these signals are time‐dependent. The SERS spectra corresponding to DNA from Arnica, Dianthus, Fragaria and Kalanchoe leaves show well‐resolved, accurate bands, providing thus a high molecular structural information content. Based on this work, specific plant DNA–ligand interactions or DNA structural changes induced by plant stress conditions associated with their natural environment might be further investigated using SERS spectroscopy. Besides, this study will generate information that is valuable in the development of label‐free DNA‐based nanosensors for chemical probing in the living cell. Copyright © 2011 John Wiley & Sons, Ltd.     

Well-posedness of a moving-boundary problem with two moving reaction strips

We deal with a one-dimensional coupled system of semi-linear reaction-diffusion equations in two a priori unknown moving phases driven by a non-local kinetic condition. The PDEs system models the penetration of gaseous carbon dioxide in unsaturated porous materials (like concrete). The main issue is that the strong competition between carbon dioxide diffusion and the fast reaction of carbon dioxide with calcium hydroxide–which are the main active reactants–leads to a sudden drop in the alkalinity of concrete near the steel reinforcement. This process–called concrete carbonation–facilitates chemical corrosion and drastically influences the lifetime of the material. We present details of a class of moving-boundary models with kinetic condition at the moving boundary and address the local existence, uniqueness and stability of positive weak solutions. We also point out our concept of global solvability. The application of such moving-boundary systems to the prediction of carbonation penetration into ordinary concrete samples is illustrated numerically.     

A multiscale Galerkin approach for a class of nonlinear coupled reaction-diffusion systems in complex media

A Galerkin approach for a class of multiscale reaction-diffusion systems with nonlinear coupling between the microscopic and macroscopic variables is presented. This type of models are obtained e.g. by upscaling of processes in chemical engineering (particularly in catalysis), biochemistry, or geochemistry. Exploiting the special structure of the models, the functions spaces used for the approximation of the solution are chosen as tensor products of spaces on the macroscopic domain and on the standard cell associated to the microstructure. Uniform estimates for the finite dimensional approximations are proven. Based on these estimates, the convergence of the approximating sequence is shown. This approach can be used as a basis for the numerical computation of the solution.     

The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

UV (275 nm) resonance Raman spectra of LacDNA 22‐mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn²⁺ and Ca²⁺ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti‐sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca²⁺ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn²⁺ and Ca²⁺) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn²⁺ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm⁻¹. Copyright © 2013 John Wiley & Sons, Ltd.     

Dynamics of pedestrians in regions with no visibility— A lattice model without exclusion

We investigate the motion of pedestrians through obscure corridors where the lack of visibility (due to smoke, fog, darkness, etc.) hides the precise position of the exits. We focus our attention on a set of basic mechanisms, which we assume to be governing the dynamics at the individual level. Using a lattice model, we explore the effects of non-exclusion on the overall exit flux (evacuation rate). More precisely, we study the effect of the buddying threshold (of no-exclusion per site) on the dynamics of the crowd and investigate to which extent our model confirms the following pattern revealed by investigations on real emergencies: If the evacuees tend to cooperate and act altruistically, then their collective action tends to favor the occurrence of disasters. The research reported here opens many fundamental questions and should be seen therefore as a preliminary investigation of the very complex behavior of the people and their motion in dark regions.     

Large‐time behavior of a two‐scale semilinear reaction–diffusion system for concrete sulfatation

We study the large‐time behavior of (weak) solutions to a two‐scale reaction–diffusion system coupled with a nonlinear ordinary differential equations modeling the partly dissipative corrosion of concrete (or cement)‐based materials with sulfates. We prove that as t → ∞ , the solution to the original two‐scale system converges to the corresponding two‐scale stationary system. To obtain the main result, we make use essentially of the theory of evolution equations governed by subdifferential operators of time‐dependent convex functions developed combined with a series of two‐scale energy‐like time‐independent estimates. Copyright © 2014 John Wiley & Sons, Ltd.     

Well-posedness and approximation of a measure-valued mass evolution problem with flux boundary conditions

This Note deals with imposing a flux boundary condition on a non-conservative measure-valued mass evolution problem posed on a bounded interval. To establish the well-posedness of the problem, we exploit particle system approximations of the mass accumulation in a thin layer near the active boundary. We derive the convergence rate for the approximation procedure as well as the structure of the flux boundary condition in the limit problem.     

Synthesis and Stereochemistry of Some New 1,3-Dioxane Derivatives of 1,4-Diacetylbenzene

 The synthesis and stereochemistry of new 1,3-dioxane derivatives of 1,4-diacetylbenzene are reported. The anancomeric structure of these compounds, the axial orientation of the aryl group for both 1,3-dioxane rings, and the cis and trans isomerism of some of these compounds is discussed considering data of conformational analysis, NMR investigations, and single crystal X-ray diffractometry.