2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Solid-phase synthesis of imidazo[4,5-b]pyridin-2-ones and related urea derivatives by cyclative cleavage of a carbamate linkage

A solid-phase synthesis of substituted cyclic urea derivatives as potential heterocyclic library scaffolds is described. 2-Amino-3-nitropyridine is attached to Wang resin via a carbamate linkage. Reduction of the nitro group was achieved with SnCl(2).2H(2)O. Reductive alkylation with a range of substituted benzaldehydes followed by cyclative cleavage afforded a small library of 3-substituted imidazo[4,5-b]pyridine-2-ones in 33-45% yield and 59-88% purity. Subsequently, this methodology was applied to the synthesis of 3-substituted imidazo[4,5-f]quinolin-2-ones.     

Die Hydrolyse von Phospholinsäureamiden

Hydrolysis of Amides of Phospholinic Acid The acid catalysed hydrolysis of (= OAP, R = organic substituent) has been investigated kinetically. Provided the pH remains constant, the hydrolysis is a first order reaction. From the temperature dependance of the rate constant the activation energy E_a as well as the thermodynamic data ΔH* and ΔS* have been calculated. In comparison to the compound with R = H aromatic substituents and additional the t-butyl group enhance E_a whilst aliphatic substituents included the benzyl group diminish E_a. The first step of the reaction is a protonation at the oxygen or nitrogen resulting in the formation of an equilibrium. After the determination of the basicity constant K_A of some OAPs it was possible to calculate the respective rate constants of the rate determining step of the reactions and the corresponding thermodynamic data E_F, ΔH and ΔS. It is assumed that the mechanism of the hydrolysis takes place according to the same scheme which has been assumed for the hydrolysis of cyclic esters of the phosphinic acid by Ugi [1] and colaborators.     

Novel metathesis catalysts based on ruthenium 1,3-dimesityl-3,4,5,6-tetrahydropyrimidin-2-ylidenes: synthesis, structure, immobilization, and catalytic activity

The synthesis of novel ruthenium-based metathesis catalysts containing the saturated 1,3-bis(2,4,6-trimethylphenyl)-3,4,5,6-tetrahydropyrimidin-2-ylidene ligand, that is, [RuCl2(NHC)[=CH-2-(2-PrO)-5-NO(2)-C6H3]] (1) and [Ru(CF3COO)2(NHC)[=CH-2-(2-PrO)-5-NO2-C6H3]] (2) (NHC=1,3-bis(2,4,6-trimethylphenyl)-3,4,5,6-tetrahydropyrimidin-2-ylidene) is described. Both catalysts are highly active in ring-closing metathesis (RCM) and ring-opening cross-metathesis (ROCM). Compound 1 shows moderate activity in enyne metathesis. Compound 2 is not applicable to enyne metathesis since it shows high activity in the cyclopolymerization of diethyl dipropargylmalonate (DEDPM). Poly(DEDPM) prepared by the action of 2 consists of 95% five-membered rings, that is, poly(cyclopent-1-enevinylene)s, and 5 % of six-membered rings, that is, poly(cyclohex-1-ene-3-methylidene)s. The polymerization proceeds in a nonliving manner and results in polyenes with broad polydispersities (1.9< or =PDI< or =2.3). Supported analogues of 2 were prepared by immobilization on hydroxymethyl-Merrifield resin and a monolithic support derived from ring-opening-metathesis polymerization (ROMP). Catalyst loadings of 1 and 2.5%, respectively, were obtained. Both supported versions of 2 showed excellent reactivity. With 0.24-2% of the supported catalysts, yields in RCM and ROCM were in the range of 76-100%. Leaching of ruthenium was low and resulted in Ru contaminations of the products of less than 0.000014% (0.14 ppm).     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

Electrospray ionization ion-trap multistage mass spectrometric study of sodium cationized aldobiuronic and pseudoaldobiuronic acid derivatives

Fragmentation mechanisms of electrospray ionization (ESI) mass spectrometry of aldobiuronic and pseudoaldobiuronic acid derivatives were elucidated by multistage mass spectrometric (MS(n), n = 2-5) measurements of selected ions. Characteristic under the conditions of ESI-MS analysis is the production of alkali metal (Na and K) cationized adducts. The probability the of locations of Na cations in per-O-methylated compounds was proved by quantum chemical calculations, using the Jaguar program. The most probably position of alkali metal attachment is the carboxy group of the methoxycarbonyl C-5 group of the uronic acid unit. Characteristic cleavages vary according the kind of O-derivatization. In most cases they take place on the acidic part of the dimer and at the interglycosidic oxygen atom. As a result, the criteria for the differentiation of aldobiouronic and pseudoaldobiouronic acids derivatives were elucidated.     

Binary and ternary chromium(III) complexes with cellular reductants and DNA components isolated from redox type systems. Part 1. Chromium(VI)–cysteine–adenine (adenosine,ATP)

The reduction of CrO₃ with an excess of L-cysteine and its interaction with DNA fragments (adenine, adenosine) and ATP nucleotide was studied by analysis of the isolated solid products. The precipitates were characterised by elemental analyses, FAB mass spectral data, spectroscopic methods (u.v.–vis., f.i.r., i.r.) and magnetic measurements. The Cr^III complexes obtained appear to be various Cr^III cysteinate and adenine or ATP (but not adenosine) ternary species of the addition type bound through the hydrogen bonding network.     

Amperometric biosensor for the rapid determination of salicylate in whole blood

A method for the determination of salicylate in whole blood is described. The assay uses salicylate hydroxylase to convert salicylate to catechol in the presence of NADH and molecular oxygen. The formation of catechol is monitored amperometrically by oxidation at +300 mV vs.Ag/AgCl and the size of the oxidation current is related to the concentration of salicylate in the sample. The reagents are incorporated into the working electrode of a disposable strip, allowing measurements to be made on a drop of blood within 1 min. The functional range of the assay can be extended to the equivalent of 7.2 mM plasma salicylate by incorporating benzoate as a component of the reaction system. The method has the advantages of simplicity and speed compared with standard procedures, and should prove especially useful in suspected overdose situations.     

Zur Kenntnis des Phosphatstoffwechsels der Hefe

Scheinbare Divergenzen zwischen den seinerzeit aufgestellten Phosphatbilanzen in Säureextrakten aus phosphatangereicherter und-verarmter Hefe und den in der letzten Mitteilung dieser Reihe erhobenen Befunden über den Gehalt an freien Nucleotiden in demselben Material, veranlaßten eine genauere Überprüfung der Frage, inwieweit die Extraktionsmethoden die Ergebnisse der Nucleotidbestimmung und der Phosphatbilanzen beeinflussen. Es zeigte sich, daß bei Bestimmung der freien Nucleotide, trotz Verwendung verschiedener Extraktionsmittel, sowohl qualitativ als auch quantitativ weitgehend entsprechende Ergebnisse erhalten wurden.Die Resultate können wieder in dem Sinne erklärt werden, daß während der Phosphatanreicherung eine Synthese von Nucleinsäure auf Kosten der freien Nucleotide erfolgt.Gleichzeitig durchgeführte Phosphatbilanzen in den Säureextrakten aus phosphat-verarmter und-angereicherter Hefe ergaben je nach den Extraktionsbedingungen starke, zur Zeit noch schwer deutbare Konzentrationsunterschiede in den einzelnen Phosphatfraktionen.

---

---

Mit 2 Abbildungen     

Synthesis and properties of 1-(6-methoxy)-2-benzothiazolyl)-2-pyridones

Substituted ]-(6-methoxy-2-benzothiazolyt)-2-pyridones were prepared from 2-amino-6-methoxybenzathiazate through N-(6-methoxy-2-benzothiazotyl) cyanvorearmileaznd-3-aryl-N-(6-methoxy-2-benzothiazolyt)-2-cyano-2-propenamides. The cyclization of the latter with malonodinitrile in the presence of piperidine gave the corresponding pyridones. The structures of the synthesized compounds were confirmed by¹H NMR and mass spectral data.Department of Organic Chemistry, Mass Spectrometry Laboratory, Slovak Technical University, 812 37 Bratislava, Slovakia. Published in Khimiya Geterotsiklicheskikh Soedinenii, No. 10, pp. 1402–1404, October, 1995. Original article submitted August 24, 1995.