Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Gadolinium‐Decorated Silica Microspheres as Redox‐Responsive MRI Probes for Applications in Cell Therapy Follow‐Up

The redox microenvironment within a cell graft can be considered as an indicator to assess whether the graft is metabolically active or hypoxic. We present a redox‐responsive MRI probe based on porous silica microparticles whose surface has been decorated with a Gd‐chelate through a disulphide bridge. Such microparticles are designed to be interspersed with therapeutic cells within a biocompatible hydrogel. The onset of reducing conditions within the hydrogel is paralleled by an increased clearance of Gd, that can be detected by MRI.     

The combi-CLEA approach: enzymatic cascade synthesis of enantiomerically pure (S)-mandelic acid

Enantiomerically pure (S)-mandelic acid was synthesised from benzaldehyde by sequential hydrocyanation and hydrolysis in a bienzymatic cascade at starting concentrations up to 0.25 M. A cross-linked enzyme aggregate (CLEA) composed of the (S)-selective oxynitrilase from Manihot esculenta and the non-selective nitrilase from Pseudomonas fluorescens EBC 191 was employed as the biocatalyst. The nitrilase produces approx. equal amounts of (S)-mandelic acid and (S)-mandelic amide from (S)-mandelonitrile under standard conditions, but we surprisingly found that high (up to 0.5 M) concentrations of HCN induced a marked drift towards amide production. By including the amidase from Rhodococcus erythopolis in the CLEA we obtained (S)-mandelic acid as the sole product in 90% yield and >99% enantiomeric purity.     

Chemoenzymatic synthesis of highly enantiomerically enriched secondary alcohols with a thiazolic core

Stereoselective preparative enzymatic acylation and hydrolysis/methanolysis of various C-substituted rac-thiazol-2-yl-methanols were achieved for the preparation of enantiopure or enantiomerically enriched, naturally occurring 2-hydroxymethylthiazoles. The absolute configurations of the resulting secondary alcohols were determined by a detailed ¹H NMR study of Mosher’s derivatives.     

Associating divisors with quadratic differentials on Klein surfaces

We extend the notion and basic properties of quadratic differential divisors to a Klein surface, using the corresponding form’s divisors from the double cover of the Klein surface.     

Mild,Rapid, and Inexpensive Microwave-Assisted Synthesis of Allylic and Propargylic Esters

A variety of allylic and propargylic esters were rapidly prepared via microwave heating of their corresponding mixed anhydride derived from pivaloyl chloride. The reaction conditions were modified to account for the sterics of the alcohol and the electronics of the carboxylic acid.

Supplemental materials are available for this article. Go to the publisher's online edition of Synthetic Communications® to view the free supplemental file.     

Solvent-Free Microwave-Assisted Organic Reactions Preparation of β-Keto Esters

Microwave technique has been utilised in the preparation of β-keto esters. Two different procedures are described: transesterification of β-keto esters and ring opening of 2,2,6-trimethyl-1,3-dioxin-4-one.     

Synthesis and cytotoxicity evaluation of diastereoisomers and N-terminal analogues of tubulysin-U

Tubulysins are potent anti-mitotic natural compounds and a scalable and efficient synthetic route for generation of its analogues has been developed and extended to the synthesis of diastereoisomers and N-terminal analogues of tubulysin-U. Structure–activity-relationship studies on these synthetic analogues reaffirmed the significance of native stereochemistry of tubulysins for optimal biological activity and cytotoxicity. However, while modification of Tup stereochemistry has only minor effect on the tubulysins cytotoxicity, Tuv stereochemistry is critically important and modification of either Tuv stereocentre produced a dramatic drop in cytotoxicity.     

金纳米粒子在TiO2气凝胶基质上的行为: 光催化活性评价和结构研究

TiO2 -Au aerogels containing different amounts of gold nanoparticles of different sizes (5 and 16 nm) were successfully synthesized using a sol-gel procedure, and were tested for salicylic acid photodegradation under UV irradiation. The structure and morphology of the obtained materials were investigated using X-ray diffraction, transmission electron microscopy, and N2 adsorption-desorption measurements. UV-Vis spectroscopy was used to study the optical properties. The effects of the gold nanoparticles on the TiO2 crystallization process were twofold, as follows: (i) the number of crystallized zones was strongly related to the concentration of the gold nanoparticles, and (ii) the smaller gold particles increased the time taken for the crystallization of the samples. It was found that the noble metal-doped samples exhibited higher degradation rates compared with bare titania. It was found that the most active photocatalyst in each studied system was the sample with the highest concentration of gold nanoparticles. Additionally, the highest degradation rate value was obtained with the smallest Au nanoparticles (46.4 10-3 μmol/(L·s).