Analysis and interpretation of excess molar properties of amphiphile + water systems : Part 3. Excess molar volumes of isopropoxyethanol + water and isobutoxyethanol + water

Excess molar volumes at 25°C, are reported for the systems isoPrOEtOH + water and isoBuOEtOH + water across their entire composition ranges. These data have been compared to those for their normal alkyl analogs in order to assess the effects of both - and β-chain branching.

The results are discussed in terms of the relative abilities of the amphiphiles to form structured aggregates.     

Stereochemistry of cyclobutanone resulted from cycloadditions of t-butylcyanoketene to bicyclo[2.2.1]heptene derivatives, as evidence for a π2s+π2a reaction mode

The stereochemistry of the cyclobutanones 1-7, resulted from the reaction of t-butylcyanoketene with bicyclo[2.2.1]heptene, bicyclo[2.2.1]heptadiene, 1,4 - dihydro - 1,4 - methanonaphthalene, 1,4 - dihydro - 9 - (1 - methylethylidene) - 1,4 - methanonaphthalene, 1,4 - dihydro - 1,4 - epoxynaphthalene, l,4,4a,8b - tetrahydro - 1,4 - methanobiphenylene (l,4,4a,8b) and 1,4,4a,8b - tetrahydro - 1,4 - methanobiphenylene(1,4,4aβ,8bβ) was established as having the cyclobutanone ring exo and the t-Bu group in the configuration. These findings represent a stereochemical argument in favour of a _π2_s + _π2_a reaction mode of t-butylcyanoketene to the above mentioned bicyclo[2.2.1]heptene derivatives. Observations regarding preservation of the original configurations of alkenes as well as the geometrical distorsion of the cyclobutanones are shortly discussed.     

Dynamic kinetic resolution of transient hemiketals: a strategy for the desymmetrisation of prochiral oxetanols

Identification of an electron poor trifluoroacetophenone allows the formation of uniquely stable hemiketals from prochiral oxetanols. When exposed to a cobalt(ii) catalyst, efficient ring-opening to densely functionalized dioxolanes is observed. Mechanistic studies suggest an unprecedented redox process between the cobalt(ii) catalyst and the hemiketal that initiates the oxetane-opening. Based on this observation, a dynamic kinetic resolution of the transient hemiketals is explored that uses a Katsuki-type ligand for stereoinduction (up to 99 : 1 dr and 96 : 4 er) and allows a variety of 1,3-dioxolanes to be accessed (20 examples up to 98% yield).

Desymmetrization of prochiral oxetanols via an electron-deficient hemiketal intermediate is achieved. Key to this process is the catalyst''s chiral recognition of one of the two hemiketal enantiomers enabling an efficient dynamic kinetic resolution.     

New Chemotypes for the Inhibition of (p)ppGpp Synthesis in the Quest for New Antimicrobial Compounds

Antimicrobial resistance (AMR) poses a serious threat to our society from both the medical and economic point of view, while the antibiotic discovery pipeline has been dwindling over the last decades. Targeting non-essential bacterial pathways, such as those leading to antibiotic persistence, a bacterial bet-hedging strategy, will lead to new molecular entities displaying low selective pressure, thereby reducing the insurgence of AMR. Here, we describe a way to target (p)ppGpp (guanosine tetra- or penta-phosphate) signaling, a non-essential pathway involved in the formation of persisters, with a structure-based approach. A superfamily of enzymes called RSH (RelA/SpoT Homolog) regulates the intracellular levels of this alarmone. We virtually screened several fragment libraries against the (p)ppGpp synthetase domain of our RSH chosen model Rel_Seq, selected three main chemotypes, and measured their interaction with Rel_Seq by thermal shift assay and STD-NMR. Most of the tested fragments are selective for the synthetase domain, allowing us to select the aminobenzoic acid scaffold as a hit for lead development.     

Shear-induced particle segregation in binary mixtures:Verification of a percolation theory

Granular materials composed of different-sized grains may experience undesired segregation.Segrega-tion is detrimental for a lot of industries because it leads ...     

Analysis of Plant–Plant Interactions Reveals the Presence of Potent Antileukemic Compounds

A method to identify anticancer compounds in plants was proposed based on the hypothesis that these compounds are primarily present in plants to provide them with an ecological advantage over neighboring plants and other competitors. According to this view, identifying plants that contain compounds that inhibit or interfere with the development of other plant species may facilitate the discovery of novel anticancer agents. The method was developed and tested using Magnolia grandiflora, Gynoxys verrucosa, Picradeniopsis oppositifolia, and Hedyosmum racemosum, which are plant species known to possess compounds with cytotoxic activities. Plant extracts were screened for growth inhibitory activity, and then a thin-layer chromatography bioautography assay was conducted. This located the major antileukemic compounds 1, 2, 4, and 5 in the extracts. Once the active compounds were located, they were extracted and purified, and their structures were determined. The growth inhibitory activity of the purified compounds showed a significant correlation with their antileukemic activity. The proposed approach is rapid, inexpensive, and can easily be implemented in areas of the world with high biodiversity but with less access to advanced facilities and biological assays.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.