Quality of Soybean Products in Terms of Essential Amino Acids Composition

The content of protein, moisture content and essential amino acids in conventional and genetically modified soybean grain and selected soybean products (soybean pâté, soybean drink, soybean dessert, tofu) was analyzed in this paper. The following comparative analysis of these products has not yet been carried out. No differences were observed in the amino acid profiles of soybeans and soybean products. The presence of essential amino acids was confirmed except for tryptophan. Its absence, however, may be due not to its absence in the raw material, but to its decomposition as a result of the acid hydrolysis of the sample occurring during its preparation for amino acid determination. Regardless of the type of soybean grain, the content of protein, moisture content and essential amino acids was similar (statistically insignificant difference). Thus, the type of raw material did not determine these parameters. There was a significant imbalance in the quantitative composition of essential amino acids in individual soybean products. Only statistically significant variation was found in genetically modified and conventional soybean pâté. Moreover, in each soy product their amount was lower irrespective of the raw material from which they were manufactured. Therefore, the authors indicate the necessity of enriching soybean products with complete protein to increase their nutritional value.     

Tunable highly birefringent solid-core photonic liquid crystal fibers

Experimental results of temperature-, electric field-, and hydrostatic-pressure-induced effects in solid-core highly birefringent photonic liquid crystal fibers are presented. Selective infiltration of the photonic crystal fibers with liquid crystals was found to induce birefringence axes switching resulting in a variety of tunable photonic liquid crystal fibers-based devices.     

Electron ionization mass spectra of aryl- and benzyl-substituted 2,3-dihydroimidazo[1,2-a]pyrimidine-5,7(1H,6H)-diones

The electron ionization mass spectra of the 1-phenyl-, 1-benzyl- and 6-benzyl-1-phenyl-2,3-dihydroimidazo[1,2-a]pyrimidine-5,7(1H,6H)-dione derivatives were recorded at 70 eV to find out the effects of substituents on their fragmentations. Fragmentation pathways were studied using B/E and B(2)/E scans. Some fragmentations involved the loss of C(3)HO(2) or carbon suboxide. The possibility of keto-enol tautomerism was also studied. For comparison selected compounds were studied using (1)H and (13)C NMR spectroscopy to reveal the presence of possible tautomerism. Some ions including [M-OH](+) and [M-HCO](+) and NMR results indicate that the enol form is predominant both in the gas and in the liquid phase.     

pH-tunable equilibria in azocrown ethers with histidine moieties

The crown ethers with electro- and photoactive azo moieties containing substituents with mobile protons such as in the -COOH groups of histidine, show unique effect of pH switched on/off presence of the azo form. The differences observed for the electrochemical behavior of azocrown ethers with N-acetylhistidine and imidazole moieties reveal the interference of a chemical reduction pathway in strongly acidified solutions. This chemical reduction process leads to the formation of a hydrazine derivative which can be detected by its further electroreduction on the electrode surface. The involvement of chemical reduction is seen clearly in the presence of mobile protons of the -COOH group and mercury as the electrode substrate. The behaviour of the N-acetylhistidine azomacrocyle is similar to that of compounds known to exist in quinone-hydrazone tautomeric equilibria.     

How to Identify Roast Defects in Coffee Beans Based on the Volatile Compound Profile

The aim of this study was to detect and identify the volatile compounds in coffee that was obtained in defect roast processes versus standard roasting and to determine the type and strength of the correlations between the roast defects and the volatile compound profile in roasted coffee beans. In order to achieve this goal, the process of coffee bean roasting was set to produce an underdeveloped coffee defect, an overdeveloped coffee defect, and defectless coffee. The “Typica” variety of Arabica coffee beans was used in this study. The study material originated from a plantation that is located at an altitude of 1400–2000 m a.s.l. in Huehuetenango Department, Guatemala. The analyses were carried out with the use of gas chromatography/mass spectrometry (GC–MS) and an electronic nose. This study revealed a correlation between the identified groups of volatile compounds and the following coffee roasting parameters: the time to the first crack, the drying time, and the mean temperatures of the coffee beans and the heating air. The electronic nose helped to identify the roast defects.     

Organometallic vanadium-based heterogeneous catalysts for ethylene polymerization. Study of the deactivation process

Slurry polymerizations of ethylene over vanadium catalysts (based on VCl₄ and VOCl₃) and their MgCl₂(THF)₂-supported equivalents were studied. Unsupported vanadium catalysts were found to be unstable while the vanadium active sites deposited on the MgCl₂(THF)₂ complex are stable. A sharply outlined correlation was found between the concentration of vanadium(III) and catalyst productivity. The high activity and stability of the vanadium catalyst when supported on the magnesium complex is attributed to the increase of resistance to reduction of active vanadium(III) to inactive vanadium(II) by an organoaluminium co-catalyst.     

Why are SiX5(-) and GeX5(-) (X = F, Cl) stable but not CF5(-) and CCl5(-)?

The possible existence of the CF(5)(-), CCl(5)(-), SiF(5)(-), SiCl(5)(-), GeF(5)(-), and GeCl(5)(-) anions has been investigated using ab initio methods. The species containing Si and Ge as central atoms were found to adopt the D(3h)-symmetry trigonal bipyramidal equilibrium structures whose thermodynamic stabilities were confirmed by examining the most probable fragmentation channels. The ab initio re-examination of the electronic stabilities of the SiF(5)(-), SiCl(5)(-), GeF(5)(-), and GeCl(5)(-) anions [using the OVGF(full) method with the 6-311+G(3df) basis set] led to the very large vertical electron detachment (VDE) energies of 9.316 eV (SiF(5)(-)) and 9.742 eV (GeF(5)(-)), whereas smaller VDEs of 6.196 and 6.452 eV were predicted for the SiCl(5)(-) and GeCl(5)(-) species, respectively. By contrast, the high-symmetry and structurally compact anionic CF(5)(-) and CCl(5)(-) systems cannot exist due to the strongly repulsive potential predicted for the X(-) (F(-) or Cl(-)) approaching the CX(4) (CF(4) or CCl(4)). The formation of weakly bound CX(4)···X(-) (CF(4)···F(-) and CCl(4)···Cl(-)) anionic complexes (consisting of pseudotetrahedral neutral CX(4) with the weakly tethered X(-)) might be expected at low temperatures (approaching 0 K), whereas neither CX(5)(-) (CF(5)(-), CCl(5)(-)) systems nor CX(4)···X(-) (CF(4)···F(-) and CCl(4)···Cl(-)) complexes can exist in the elevated temperatures (above 0K) due to their susceptibility to the fragmentation (leading to the X(-) loss).     

Sorption of platinum on immobilized microorganisms for its on-line preconcentration and chemiluminescent determination in water samples

Fungi of the type Aspergillus sp. were immobilized on a cellulosic resin and used as a biosorbent for the on-line preconcentration and separation of Pt(IV) ions prior to their chemiluminescent determination via flow injection analysis. Biosorption and elution conditions were optimized, and the results compared to biosorbents based on the use of Chlorella vulgaris algae and Saccharomyces cerevisiae yeast in terms of preconcentration and selective retention of Pt(IV). The immobilized fungi presented here have a high potential for use in platinum biosorption. The procedure exhibits the currently lowest limit of detection (0.02 ng mL^?1 of Pt) and very high selectivity. The procedure was applied to the determination of Pt(IV) in river water, road run-off, and wastewater samples.

Estimation of trioctylphosphine oxide (TOPO) diffusion coefficients by dynamic adsorption measurements in model extraction systems

Equilibrium interfacial tension and surface excess isotherms for trioctylphosphine oxide (TOPO) were determined and interpreted. Despite its high hydrophobicity, TOPO adsorbs at the hydrocarbon/water interfaces and decreases effectively the interfacial tension. The interfacial activity of TOPO is affected by the type of organic diluent and the composition of the aqueous phase, i.e., the kind (HNO(3), KNO(3)) and the concentration of nonorganic electrolyte present in the system. Significant lowering of TOPO interfacial activity is observed with an increase of the aqueous phase acidity. The dynamic interfacial tension for TOPO was measured by using the drop volume technique. With the aid of the Ward and Tordai equation the values of the diffusion coefficients of TOPO were estimated. The values determined were in the right order of magnitude compared with the literature data.     

5′-Terminal chemical capping of spliced leader RNAs

Spliced leader (SL) RNA trans-splicing adds a N²,N²,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5′ end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5′-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3′ biotin tag.