Enantioselective inhibition of immobilized acetylcholinesterase in biosensor determination of pesticides

Chiral effects for the inhibition of acetylcholinesterase by organophosphorus pesticides were investigated for insecticide malathion and malaoxon, which is a metabolic product of malathion in living organisms. Studies were carried out using a bienzymatic biosensor with immobilized acetylcholinesterase, choline oxidase, and with Prussian Blue used as a mediator. In both cases the R enantiomers accelerate acetylocholinesterase inhibition. The chiral effect in inhibition was much more pronounced in fast flow measurements than in batch measurements.      

5′-Terminal chemical capping of spliced leader RNAs

Spliced leader (SL) RNA trans-splicing adds a N²,N²,7-trimethylguanosine cap (TMG) and a 22-nucleotide sequence, the SL, to the 5′ end of mRNAs. Both non-trans-spliced with a monomethylguanosine cap (MMG) and trans-spliced mRNAs co-exist in trans-splicing metazoan cells. Efficient translation of TMG-capped mRNAs in nematodes requires a defined core of nucleotides within the SL sequence. Here we present a chemical procedure for the preparation and purification of 5′-terminal capped MMG and TMG wild-type, and mutant 22 nt spliced leader RNAs (GGU/ACUUAAUUACCCAAGUUUGAG) with or without a 3′ biotin tag.     

Unusual ion UO4? formed upon collision induced dissociation of [UO2(NO3)3]?, [UO2(ClO4)3]?, [UO2(CH3COO)3]? ions

The following ions [UO₂(NO₃)₃]⁻, [UO₂(ClO₄)₃]⁻, [UO₂(CH₃COO)₃]⁻ were generated from respective salts (UO₂(NO₃)₂, UO₂(ClO₄)₃, UO₂(CH3COO)2) by laser desorption/ionization (LDI). Collision induced dissociation of the ions has led, among others, to the formation of UO₄ ⁻ ion (m/z 302). The undertaken quantum mechanical calculations showed this ion is most likely to possess square planar geometry as suggested by MP2 results or strongly deformed geometry in between tetrahedral and square planar as indicated by DFT results. Interestingly, geometrical parameters and analysis of electron density suggest it is an U^VI compound, in which oxygen atoms bear unpaired electron and negative charge.     

Ethylene/POSS copolymerization behavior of postmetallocene catalysts and copolymer characteristics

Copolymerization of ethylene with iso‐butyl substituted monoalkenyl(siloxy)‐ or monoalkenylsilsesquioxane (POSS) comonomers over bis(phenoxy‐imine) and salen‐type titanium and zirconium catalysts was studied. It was found that the polyreaction performance was significantly depended by the kind of the catalyst and by the structure and concentration of POSS in the feed. The POSS comonomer was efficiently incorporated into the polymer chain at up to 0.2 mol %. The differences in the copolymer compositions as the functions of the catalyst kind and the POSS comonomer were observed, including the varied number‐average sequence length of ethylene and unsaturated end groups, as determined by ¹H NMR and FT‐IR. The presence of POSS comonomers affected also the melting and crystallization behavior of the copolymers, as evidenced by DSC, because of influence on the polymer chain arrangement. The POSS units could act as the nucleating agents. Moreover, the crystal and structural parameters of ethylene/POSS copolymers were evaluated on the basis of X‐ray results, and the limited self‐aggregation of POSS incorporated into the polymer chain, the small number and size of POSS aggregates, and the increased crystallinity degree of copolymers were demonstrated. The ethylene/POSS copolymers produced by postmetallocenes offered also high thermal stability and interesting morphological properties. © 2017 Wiley Periodicals, Inc. J. Polym. Sci., Part A: Polym. Chem. 2017 , 55, 3918–3934     

Assessment of elemental contamination in the bottom sediments from a dam reservoir using a sequential extraction technique and chemometric analysis

The concentration of elements in sediments is an important aspect of the quality of water ecosystems. The element concentrations in bottom sediments from Goczalkowice Reservoir, Poland, were investigated to determine the levels, accumulation and distribution of elements; to understand the contamination and potential toxicity of elements; and to trace the possible source of pollution. Sediments were collected from 8 sampling points. The functional speciation, mobility and bioavailability of elements were evaluated by means of modified Tessier sequential extraction. The element contents were measured by optical emission spectrometry with inductively coupled plasma. The experimental results were analyzed using chemometric methods such as principal component analysis and cluster analysis to elucidate the metal distributions, correlations and associations. The highest concentrations of most elements were found at the center of the reservoir. The distribution of metals in the individual fractions was varied. To assess the extent of anthropogenic impact indices, contamination factor, degree of contamination, metal pollution index and risk assessment code were applied. The calculated factors showed the highest contamination factor and the ability of chromium to be released from sediments. The degree of contamination showed that the area is characterized by a very high contamination. Strontium and manganese showed high potential ecological risk for sediments.      

Flow methods in chiral analysis

The methods used for the separation and analytical determination of individual isomers are based on interactions with substances exhibiting optical activity. The currently used methods for the analysis of optically active compounds are primarily high-performance separation methods, such as gas and liquid chromatography using chiral stationary phases or chiral selectors in the mobile phase, and highly efficient electromigration techniques, such as capillary electrophoresis using chiral selectors. Chemical sensors and biosensors may also be designed for the analysis of optically active compounds.     

The influence of structure and concentration of cyano-terminated and terphenyl dopants on helical pitch and helical twist sense in orthoconic antiferroelectric mixtures

A bicomponent mixture in the orthoconic aniferroelectric phase, based on three-ring esters with fluorine atoms and ether group in a nonchiral chain, was doped with a variety of cyano-terminated compounds containing different numbers of phenyl rings in a rigid core and a terminal chain of different chirality. Compounds with two chiral chains were added to the basic mixture. The influence of the structure and concentration of dopant on the temperature-dependence of helical parameters, such as helical pitch and twist sense, were assessed by spectrophotometric and polarimetric methods. Long cyano-terminated compounds were found to be better than the other dopants tested for improving the usable properties of the antiferroelectric mixtures.     

CXCR4‐Targeted and MMP‐Responsive Iron Oxide Nanoparticles for Enhanced Magnetic Resonance Imaging

MRI offers high spatial resolution with excellent tissue penetration but it has limited sensitivity and the commonly administered contrast agents lack specificity. In this study, two sets of iron oxide nanoparticles (IONPs) were synthesized that were designed to selectively undergo copper‐free click conjugation upon sensing of matrix metalloproteinase (MMP) enzymes, thereby leading to a self‐assembled superparamagnetic nanocluster network with T₂ signal enhancement properties. For this purpose, IONPs with bioorthogonal azide and alkyne surfaces masked by polyethylene glycol (PEG) layers tethered to CXCR4‐targeted peptide ligands were synthesized and characterized. The IONPs were tested in vitro and T₂ signal enhancements of around 160 % were measured when the IONPs were incubated with cells expressing MMP2/9 and CXCR4. Simultaneous systemic administration of the bioorthogonal IONPs in tumor‐bearing mice demonstrated the signal‐enhancing ability of these ‘smart’ self‐assembling nanomaterials.     

Tetraazuliporphyrin Tetracation

At the crossroads : A unique carbon‐bridged annulene motif—dehydroquatyrin—is imprinted into the molecular structure of the tetraazuliporphyrin tetracation (see picture). The macrocycle, which lies at the intersection of annulene, carbocation, and porphyrin chemistry, is obtained by the standard condensation of azulene and arylaldehyde followed by oxidation. The meso positions of the tetracation are susceptible to anionic or weak nucleophilic attack.