Density and Volume Properties of the 2-Chloroethanol + 2-Methoxyethanol + 1,2-Dimethoxyethane Ternary Solvent System at Different Temperatures

The density of the 2-chloroethanol (CE) + 2-methoxyethanol (ME) + 1,2-dimethoxye- thane (DME) ternary mixtures has been measured at different temperatures ranging from –10 to 80^°C, and over the entire composition range. The experimental data have been used to check the validity of some relationships accounting for the dependence of the density on temperature and composition domains. Starting from the primary data, some derived quantities, such as excess molar volumes V ^E, partial molar volumes and partial excess molar volumes , have been obtained. In these mixtures, V ^E is always positive for the [CE(1) + ME(2)] binaries, while it is generally negative at all other experimental conditions, showing the greatest deviations along the binary axes corresponding to the binary subsystems in the sequence [CE(1) + DME(2)] < [CE(1) + ME(2)] < [ME(1) + DME(2)]. The results are compared and discussed to in terms of changes in molecular association and structural effects in these solvent systems.     

Luminescence Properties of Platinum(II) Dithiooxamide Compounds

Tight contact ion pairs of general formula {Pt(H(2)-R(2)-dto)(2)(2+),(X(-))(2)} have been prepared, and their absorption spectra and luminescence properties (at room temperature in dichloromethane fluid solution and at 77 K in butyronitrile rigid matrix) have been studied (dto = dithiooxamide; R = methyl, X = Cl (1); R = butyl, X = Cl (2); R = benzyl, X = Cl (3); R = cyclohexyl, X = Cl (4); R = cyclohexyl, X = Br (5); R = cyclohexyl, X = I (6)). The absorption spectra of all the compounds are dominated by moderately strong Pt(dpi)/S(p) to dithiooxamide (pi) charge transfer (Pt/S --> dto CT) bands in the visible region (epsilon in the 10(4)-10(5) M(-)(1) cm(-)(1) range). Absorption features are also present at higher energies, due to pi-pi transitions centered in the dto ligands (ligand centered, LC). All the compounds exhibit a unstructured luminescence band in fluid solution at room temperature, with the maximum centered in the 700-730 nm range. The luminescence bands are blue-shifted about 4000 cm(-)(1) on passing to the rigid matrix at 77 K. Luminescence lifetimes are on the 10(-)(8)-10(-)(7) s time scale at room temperature and 1 order of magnitude longer at 77 K. Luminescence is assigned to triplet Pt/S --> dto CT excited states in all cases. Compounds 3-6 also exhibit a second higher-energy luminescence band at room temperature, centered at about 610 nm, attributed to a LC excited state. Charge transfer interactions between halides and dto ligands destabilize dto-centered orbitals, affecting the energy of Pt/S --> dto CT transitions and states. The X counterions and X --> dto CT levels are proposed to play a role in promoting excited state conversion between LC and Pt/S --> dto CT levels. The R substituents on the nitrogen atoms of the dto ligands influence the absorption and photophysical properties of the compounds, by affecting proximity of the ion pairs. The possibility to functionalize the R substituents may open the way to interface these luminescent compounds with desired substrates and to construct supramolecular assemblies.     

Exploring the Parallel G-Quadruplex Nucleic Acid World: A Spectroscopic and Computational Investigation on the Binding of the c-myc Oncogene NHE III1 Region by the Phytochemical Polydatin

Trans-polydatin (tPD), the 3-β-D-glucoside of the well-known nutraceutical trans-resveratrol, is a natural polyphenol with documented anti-cancer, anti-inflammatory, cardioprotective, and immunoregulatory effects. Considering the anticancer activity of tPD, in this work, we aimed to explore the binding properties of this natural compound with the G-quadruplex (G4) structure formed by the Pu22 [d(TGAGGGTGGGTAGGGTGGGTAA)] DNA sequence by exploiting CD spectroscopy and molecular docking simulations. Pu22 is a mutated and shorter analog of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, whose overexpression triggers the metabolic changes responsible for cancer cells transformation. The binding of tPD with the parallel Pu22 G4 was confirmed by CD spectroscopy, which showed significant changes in the CD spectrum of the DNA and a slight thermal stabilization of the G4 structure. To gain a deeper insight into the structural features of the tPD-Pu22 complex, we performed an in silico molecular docking study, which indicated that the interaction of tPD with Pu22 G4 may involve partial end-stacking to the terminal G-quartet and H-bonding interactions between the sugar moiety of the ligand and deoxynucleotides not included in the G-tetrads. Finally, we compared the experimental CD profiles of Pu22 G4 with the corresponding theoretical output obtained using DichroCalc, a web-based server normally used for the prediction of proteins’ CD spectra starting from their “.pdb” file. The results indicated a good agreement between the predicted and the experimental CD spectra in terms of the spectral bands’ profile even if with a slight bathochromic shift in the positive band, suggesting the utility of this predictive tool for G4 DNA CD investigations.     

Liquid–Liquid Phase Equilibrium and Ion-Exchange Exploration for Aqueous Two-Phase Systems of ([C4mim]Cl + K2CO3 or K3C6H5O7 + water) at Different Temperatures

Journal of Solution Chemistry - Liquid–liquid equilibrium (LLE) data and phase diagrams for new aqueous two-phase systems (ATPSs) containing 1-butyl-3-methylimidazolium chloride...     

Semiconductor Quantum Dots as Components of Photoactive Supramolecular Architectures

Luminescent quantum dots (QDs) are colloidal semiconductor nanocrystals consisting of an inorganic core covered by a molecular layer of organic surfactants. Although QDs have been known for more than thirty years, they are still attracting the interest of researchers because of their unique size-tunable optical and electrical properties arising from quantum confinement. Moreover, the controlled decoration of the QD surface with suitable molecular species enables the rational design of inorganic-organic multicomponent architectures that can show a vast array of functionalities. This minireview highlights the recent progress in the use of surface-modified QDs – in particular, those based on cadmium chalcogenides – as supramolecular platforms for light-related applications such as optical sensing, triplet photosensitization, photocatalysis and phototherapy.     

Fast electrodeposition of zinc onto single zinc nanoparticles

The zinc deposition reaction onto metallic zinc has been investigated at the single particle level through the electrode-particle collision method in neutral solutions, and in respect of its dependence on the applied potential and the ionic strength of a sulphate-containing solution. Depending on the concentration of sulphate ions in solution, different amounts of metallic zinc were deposited on the single Zn nanoparticles. Specifically, insights into the electron transfer kinetics at the single particles were obtained, indicating an electrically early reactant-like transition state, which is consistent with the rate-determining partial de-hydration/de-complexation process. Such information on the reaction kinetics at the nanoscale is of vital importance for the development of more efficient and long-lasting nanostructured Zn-based negative electrodes for Zn-ion battery applications.

     

Mycotoxins in spices and culinary herbs from Italy and Tunisia

Abstract

Spices and aromatic herbs can be contaminated with mycotoxins, since of their preharvest, postharvest, and storage conditions. In this study, 112 samples of different spices and aromatic herbs were evaluated for their mycotoxins content by HPLC-MS/MS in order to highlight their possible risk linked with human use. The results showed that mycotoxins were occasionally detected only in samples of coriander, laurel, mint, rosemary, and verbena. In both geographical origins a different contamination was detected. Among the investigated mycotoxins, AFB2, AFG1, AFG2, T2 and HT2 were detected, whereas none of the samples contained AFB1 and FB1. The co-occurrence of two toxins were observed for some samples of rosemary and verbena. This study indicates that it is essential minimize the toxins in agriculture, industry, and food-product manufacturing for the consumer health protection.     

Exploring multiple‐cumulative trapping solid‐phase microextraction for olive oil aroma profiling

Headspace solid‐phase microextraction is a solvent‐free sample preparation technique that is based on the equilibrium among a three‐phase system, i.e., sample‐headspace‐fiber. A compromise between sensitivity and extraction time is usually needed to optimize the sample throughput, especially when a large number of samples are analyzed, as usually the case in cross‐samples studies. This work explores the capability of multiple‐cumulative trapping solid‐phase microextraction on the characterization of the aroma profiling of olive oils, exploiting the automation capability of a novel headspace autosampler. It was shown that multiple‐cumulative solid‐phase microextraction has the potential to improve the overall sensitivity and burst the level of information for cross‐sample studies by using cumulative shorter extraction times.     

An open volume, high isolation, radio frequency surface coil system for pulsed magnetic resonance

We present an open volume, high isolation, RF system suitable for pulsed NMR and EPR spectrometers with reduced dead time. It comprises a set of three RF surface coils disposed with mutually parallel RF fields and a double-channel receiver (RX). Theoretical and experimental results obtained with a prototype operating at about 100 MHz are reported. Each surface RF coil (diameter 5.5 cm) was tuned to f₀ = 100.00 ± 0.01 MHz when isolated. Because of the mutual coupling and the geometry of the RF coils, only two resonances at f₁ = 97.94 MHz and f₂ = 101.85 MHz were observed. We show they are associated with two different RF field spatial distributions. In continuous mode (CW) operation the isolation between the TX coil and one of the RX coils (single-channel) was about −10 dB. By setting the double-channel RF assembly in subtraction mode the isolation values at f₁ or f₂ could be optimised to about −75 dB. Following a TX RF pulse (5 μs duration) an exponential decay with time constant of about 600 ns was observed. The isolation with single-channel RX coil was about −11 dB and it increased to about −47 dB with the double-channel RX in subtraction mode. Similar results were obtained with the RF pulse frequency selected to f₂ and also with shorter (500 ns) RF pulses. The above geometrical parameters and operating frequency of the RF assembly were selected as a model for potential applications in solid state NMR and in free radical EPR spectroscopy and imaging.