The influence of divalent metal ions on low pH induced LacDNA structural changes as probed with UV resonance Raman spectroscopy

UV (275 nm) resonance Raman spectra of LacDNA 22‐mer duplex [d(TAATGTGAGTTAGCTCACTCAT) · d(ATGAGTGAGCTAACTCACATTA)], which contain protein binding sites within the E. coli lac promoter, were measured at two pH values (6.4 and 3.45) in the absence and presence of Mn²⁺ and Ca²⁺ metal ions, respectively. Also, the UV (275 nm) resonance Raman markers of the corresponding oligonucleotide d(TAATGTGAGTTAGCTCACTCAT) and of its complementary anti‐sense strand d(ATGAGTGAGCTAACTCACATTA) were established and tentatively assigned. Large changes in the UV (275 nm) resonance Raman spectra of LacDNA duplex were observed at pH 3.45 as compared with the corresponding spectrum at pH 6.4, in the absence of divalent metal ions and at low concentrations of Ca²⁺ ions, respectively. Major changes comprise: adenine protonation, GC base pair protonation, DNA bases unstacking and changes in the hydrogen bonding strength between the strands of different LacDNA complexes, respectively. Divalent metal ions (Mn²⁺ and Ca²⁺) were found to inhibit LacDNA protonation even at low concentrations. Manganese(II) ions are much more effective in this regard, as compared with calcium(II) ions. Binding of Mn²⁺ ions to N7 of guanine and, possibly, in a lesser extent to adenine was observed as judging from the difference Raman bands at 1315, 1354 and 1493 cm⁻¹. Copyright © 2013 John Wiley & Sons, Ltd.     

The Role of Organoclay on Microstructure Development and Rheological Properties of Poly(Butylene Terephtalate)/Epoxy/Organoclay Hybrid Systems

The main objective of the present work was to study the role of organoclay on the microstructure development and rheological properties of poly(butylene terephtalate)/ epoxy/organoclay (Cloisite® 30B) hybrid nanocomposites. The effects of feeding order and curing of the epoxy were also investigated. The hybrid nanocomposite samples were prepared by melt compounding in a laboratory internal mixer at a temperature of 240°C. The samples were prepared by three feeding routes; (1) simultaneous feeding, (2) PBT/organoclay based master batch feeding, and (3) epoxy/organoclay based master batch feeding. The XRD results evidenced a highly intercalated microstructure for all the samples. The linear viscoelastic results obtained for uncured samples, prepared by the first and second feeding routes, exhibited a pronounced low-frequency nonterminal behavior whose extent was found to be increased in the cured samples. These results suggested that the major part of the nanoclay tactoids and/or platelets were dispersed in the PBT matrix, with higher nanoclay concentration in the sample prepared by the second feeding route. However, the samples prepared through epoxy/organoclay based master batch did not exhibit an appreciable low-frequency solid body response. This suggests that the process of migration of the nanoclay tactoids and/or platelets from epoxy droplets to PBT matrix was the time consuming process due to the high aspect ratio of the nanoclay and the high viscosity of the PBT matrix. From linear and nonlinear viscoelastic measurements, it could be deduced that the curing process does not play an important role in determining the extent of intercalation and dispersion of the nanoclay, but it can enhance the interfacial interaction between the two phases in the nanocomposite.     

Observational constraints on FRW cosmologies with dark energy-dark matter interaction

In this paper, within the scope of FRW cosmology for $k=0, \pm 1$ , we investigate the dynamics of the universe in cosmological model where a scalar field nonminimally is coupled to matter field. By best-fitting the model parameters with the observational data, for the direct interaction between the dark sectors in the model, we obtain new constraints on cosmological parameters. The result with the best fitted model parameters supports the current universe acceleration in all models and shows that only in flat universe case the phantom crossing occurs twice in the past and once in the future. The best fitted reconstructed potential function and other physical functions are also obtained.     

Scattering of Relativistic Spinless Particles by the Woods–Saxon Potential

The Klein–Gordon equation with vector and scalar Woods–Saxon potentials is solved in terms of hypergeometric functions. The transmission and reflection coefficients as well as the bound state solutions are reported.     

Thermal rearrangement study of low molecular weight polybutadiene

Various polybutadienes (PBDs) of low molecular weight were heated below complete crosslinking at 250 °C under anaerobic nonpyrolytic conditions, and the structural changes were investigated. The predominant crosslinking reactions arise from the presence of 1,2-vinyl isomer and the most important one is intermolecular reaction accompanied with methyl group formation. The analysis showed that two crosslinking types as well as two types of methyl groups have been produced in which one was the result of 1,2-vinyl isomer of one chain crosslinked via methylene carbon of another chain of cis or trans isomer, and the second methyl group was the product of the reaction between 1,2-vinyl isomers of two PBD chains. Chain scission also occurred in two pathways due to the presence of 1,2-vinyl isomer, scission at two adjacent 1,2-vinyl isomer and scission at adjacent 1,2-vinyl with cis or trans isomer giving rise to methyl carbons.     

Analytical and numerical techniques for predicting the interfacial stresses of wavy carbon nanotube/polymer composites

By introducing a new simplified 3D representative volume element for wavy carbon nanotubes, an analytical model is developed to study the stress transfer in single-walled carbon nanotube-reinforced polymer composites. Based on the pull-out modeling technique, the effects of waviness, aspect ratio, and Poisson ratio on the axial and interfacial shear stresses are analyzed in detail. The results of the present analytical model are in a good agreement with corresponding results for straight nanotubes. Russian translation published in Mekhanika Kompozitnykh Materialov, Vol. 45, No. 2, pp. 299-306, March-April, 2009.     

RESONANCE RAMAN SPECTRA OF THE II-CATION RADICALS OF COPPER, COBALT, AND NICKEL METHYLOCTAETHYLCHLORINS: VIBRATIONAL CHARACTERISTICS OF CHLOROPHYLL MODELS

Abstract— By using excitation at 363.8 nm, resonance Raman (RR) spectra were obtained for Cu(II), Co(II), and Ni(II) complexes of methyloctaethylchlorin (MeOEC) and their ir-cation radicals. Additionally, the Raman spectra of the Cu(II) derivatives of (rarcs-octaethylchlorin (r-OEC) were included for comparison. The alkyl-substituted CuMeOEC exhibits a Raman spectrum that is nearly identical to that of the simpler (-CuOEC in both the neutral and oxidized states. Unlike the latter species, the cation radical of CuMeOEC is immune to oxidative dehydrogenation to porphyrin, and this has facilitated vibrational characterization of the ring-oxidized species. This study aims to compare the vibrational characteristics in the 1450 to 1700 cm^-t region of the metallochlorin ir-cation radicals to those of the corresponding oxidized metalloporphyrins. We focus on two modes in the1500–1520 cm^-1 and1620–1650 cm^-1 region that are analogous to the v₃ and v₁₀ vibrations, respectively, in the metalloporphyrin analogs. These vibrational modes are clearly defined in all species and exhibit a strong core-size dependency in the porphyrin complexes. The core-size study as well as the frequency changes upon oxidation support the conclusion that the v₃-like vibration in the chlorin species features substantial C_bC_b in addition to C_aC_m stretching character. The v,₀-like mode of the chlorin macrocycle, on the other hand, displays characteristics that closely resembles that of the porphyrin analog; consequently, these vibrations are of predominantly C_aC_m stretching character in both cases.     

Sensitive electrochemical detection of picloram utilising a multi-walled carbon nanotube/Cr-based metal-organic framework composite-modified glassy carbon electrode

This study describes the utilisation of a glassy carbon electrode modified with a composite of multi-walled carbon nanotube and Cr-based metal-organic framework (MIL-101, Cr-BDC, BDC = 1,4-benzenedicarboxylate) for the sensitive, simple and fast voltammetric determination of picloram in environmental samples. Under optimum conditions, additions of picloram using square wave voltammetry showed linear ranges of picloram concentrations from 24.15 to 3018 µg?L^?1 (0.1–12.5 μM) and from 3018 to 9658 µg?L^?1 (12.5–40 μM) with a detection limit of 14.49 µg?L^?1 (0.06 µM). The method was successfully applied to the determination of picloram in tap and river water samples spiked with picloram without any purification step by the standard addition method. The good recovery values obtained ranging from 97.5% to 105.0% revealed the reliability and accuracy of the method.