Separation of Monovinyl and Divinyl Protochlorophyllides Using C30 Reverse Phase High Performance Liquid Chromatography Column: Analytical and Preparative Applications

A new, high performance liquid chromatography method has been developed for the separation of monovinyl- and divinyl-protochlorophyllides, using commercially available, C₃₀ reverse phase column and isocratic elution. This method can be used both for analytical applications and preparative scale purification of monovinyl- and divinyl-protochlorophyllides using the same column where submilimolar concentrations of the crude protochlorophyllide extract can be separated in one run. The purity of the obtained protochlorophyllides was demonstrated by spectroscopic methods, as well by the formation of aggregates in toluene.     

Multinuclear magnetic resonance study of some mesoionic oxatriazoles containing nitrogenous exocyclic groups

¹H,¹³C,¹⁴N and¹⁵N NMR measurements are reported for four mesoionic 1-oxa-2, 3, 4-triazoles containing exocyclic nitrogenous groups. The NMR signal assignments are discussed and compared with those previously published for some corresponding oxatriazoles. The results obtained support the proposed cyclic mesoionic structures for the compounds studied. The questions of possible charge delocalization and valence tautomerism are addressed. Compound with N^– H as a exocyclic group (Fig. 1) is found to be relatively unstable, this is attributed to proton migration in the corresponding non-cyclic form of this molecule.Published in Khimiya Geterotsikiicheskikh Soedinenii, No. 9, pp. 1260–1263, September, 1995.     

A fading effect in the X-ray diffraction contrast of dislocations

Fringes in the dislocation image in X-ray section topography are shown to fade away partially when unpolarized radiation is used. The fading effect is explained in terms of an analogy with the polarization beat in a wedge crystal. The polarization nature of the phenomenon is confirmed through numerical simulations of the contrast.Dedicated to Professor Dr. Ulrich Bonse on the occasion of his 60th birthday     

Application of platinum gauze activated by hydrogen to the adsorption separation of silver traces and their determination by aas or spectrophotometry

A method ("electrosorption") has been developed for separation of silver from copper by its deposition through internal electrolysis with hydrogen adsorbed on a platinum surface. The silver can then be stripped and determined by atomic-absorption spectrometry or the dithizone method. The activation of the platinum surface with adsorbed hydrogen can be achieved either electrolytically or by passing hydrogen gas through the solution in which the platinum is immersed. The method of electrosorption has been successfully applied to determination of trace levels of silver in copper metal.     

Origin of organic gaseous products formed in the thermal decomposition of formates

The gaseous products of the thermal decomposition of formates have been investigated and compared with the products of formaldehyde and synthesis gas transformation under analogous conditions in the presence of the solids formed in the thermal decomposition of particular formates. It was found that formaldehyde transformation leads to organic compounds identical to those obtained in the thermal decomposition of the respective formates, while synthesis gas does not react under such conditions. This fact substantiates the hypothesis that formaldehyde is a precursor of the organic compounds identified in the thermal decomposition of formates. The nature of the organic componds obtained in the thermal decomposition of formates indicates that the formaldehyde formed in the initial stages is then transformed in the Cannizzaro or Tishchenko reactions.

---

Zusammenfassung Die gasförmigen Produkte der thermischen Zersetzung von Formiaten wurden untersucht und mit den Produkten verglichen, die bei der Umwandlung von Formaldehyd und Synthesegas unter analogen Bedingungen in Gegenwart von bei der thermischen Zersetzung von speziellen Formiaten gebildeten Feststoffen entstehen. Formaldehydumwandlungen führen zu organischen Verbindungen, die identisch mit denen sind, die bei der thermischen Zersetzung des betreffenden Formiats gebildet werden, während Synthesegas unter solchen Bedingungen nicht reagiert. Dies erhärtet die Hypothese, daß Formaldehyd eine Vorstufe der bei der thermischen Zersetzung von Formiaten identifizierten organischen Verbindungen ist. Die Natur der bei der thermischen Zersetzung von Formiaten auftretenden organischen Verbindungen weist darauf hin, daß das in den ersten Reaktionsschritten gebildete Formaldehyd nach der Cannizzaro-oder Tishchenko-Reaktion weiterreagiert.

---

, , . , i , . . , , . , , , .

     

Quantum spheres

Spaces homogeneous under the action of the quantum SU(2) group are introduced and investigated. These spaces can be considered as noncommutative two-dimensional spheres of different radii. The geometry of the space built from those spheres makes possible one-particle dipole electric transitions with l=0.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.