Identification of a set of genes showing regionally enriched expression in the mouse brain

Background

We have recorded responses from single neurons in murine visual cortex to determine the effectiveness of the input from the two murine cone photoreceptor mechanisms and whether there is any unique selectivity for cone inputs at this higher region of the visual system that would support the possibility of colour vision in mice. Each eye was stimulated by diffuse light, either 370 (strong stimulus for the ultra-violet (UV) cone opsin) or 505 nm (exclusively stimulating the middle wavelength sensitive (M) cone opsin), obtained from light emitting diodes (LEDs) in the presence of a strong adapting light that suppressed the responses of rods.

Results

Single cells responded to these diffuse stimuli in all areas of striate cortex. Two types of responsive cells were encountered. One type (135/323 – 42%) had little to no spontaneous activity and responded at either the on and/or the off phase of the light stimulus with a few impulses often of relatively large amplitude. A second type (166/323 – 51%) had spontaneous activity and responded tonically to light stimuli with impulses often of small amplitude. Most of the cells responded similarly to both spectral stimuli. A few (18/323 – 6%) responded strongly or exclusively to one or the other spectral stimulus and rarely in a spectrally opponent manner.

Conclusion

Most cells in murine striate cortex receive excitatory inputs from both UV- and M-cones. A small fraction shows either strong selectivity for one or the other cone mechanism and occasionally cone opponent responses. Cells that could underlie chromatic contrast detection are present but extremely rare in murine striate cortex.     

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.     

Assessment of 4-nitrogenated benzyloxymethyl groups for 2'-hydroxyl protection in solid-phase RNA synthesis

The search for a 2'-OH protecting group that would impart ribonucleoside phosphoramidites with coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites led to an assessment of 2'-O-(4-nitrogenated benzyloxy)methyl groups through solid-phase RNA synthesis using phosphoramidites 2a-d, 12a, and 14a. These phosphoramidites exhibited rapid and efficient coupling properties. Particularly noteworthy is the cleavage of the 2'-O-[4-(N-methylamino)benzyloxy]methyl groups in 0.1 M AcOH, which led to U19dT within 15 min at 90 degrees C. [reaction: see text]     

Thalassospiramides A and B, immunosuppressive peptides from the marine bacterium Thalassospira sp

[structure: see text] Two new cyclic peptides, thalassospiramides A and B (1 and 2), were isolated from a new member of the marine alpha-proteobacterium Thalassospira. The thalassospiramides, the structures of which were assigned by combined spectral and chemical methods, bear unusual gamma-amino acids and show immunosuppressive activity in an interleukin-5 production inhibition assay (IC50 = 5 muM for thalassospiramide B).     

Piperazimycins: cytotoxic hexadepsipeptides from a marine-derived bacterium of the genus Streptomyces

Three potent cancer cell cytotoxins, piperazimycins A-C (1-3), have been isolated from the fermentation broth of a Streptomyces sp., cultivated from marine sediments near the island of Guam. The structures of these cyclic hexadepsipeptides were assigned by a combination of spectral, chemical, and crystallographic methods. The piperazimycins are composed of rare amino acids, including hydroxyacetic acid, alpha-methylserine, gamma-hydroxypiperazic acid, and gamma-chloropiperazic acid. The novel amino acid residues 2-amino-8-methyl-4,6-nonadienoic acid and 2-amino-8-methyl-4,6-decadienoic acid were found as components of piperazimycins A and C, respectively. When screened in the National Cancer Institute's 60 cancer cell line panel, piperazimycin A exhibited potent in vitro cytotoxicity toward multiple tumor cell lines with a mean GI50 of 100 nM.     

In Memoriam Glenn T. Seaborg (1912-1999): Nuclear Pioneer, Educator, and Public Servant

Chemistry and History In this section we present articles by leading scientific historians that chronicle the important events, persons, and publications that make up the rich history of chemical science. The history of chemistry, of course, has taken place against the background of world history, and the articles in this section often make that very clear. Chemists and their research are always influenced by current events. These articles are intended to describe the setting in which important discoveries occurred and to humanize their discoverers.—Clifford LeMaster, Editor in Chief     

The World Is Not a Theorem

The evolution of the biosphere unfolds as a luxuriant generative process of new living forms and functions. Organisms adapt to their environment, exploit novel opportunities that are created in this continuous blooming dynamics. Affordances play a fundamental role in the evolution of the biosphere, for organisms can exploit them for new morphological and behavioral adaptations achieved by heritable variations and selection. This way, the opportunities offered by affordances are then actualized as ever novel adaptations. In this paper, we maintain that affordances elude a formalization that relies on set theory: we argue that it is not possible to apply set theory to affordances; therefore, we cannot devise a set-based mathematical theory to deduce the diachronic evolution of the biosphere.     

Analysis of permethrin isomers in composite diet samples by molecularly imprinted solid-phase extraction and isotope dilution gas chromatography–ion trap mass spectrometry

Determination of an individual's aggregate dietary ingestion of pesticides entails analysis of a difficult sample matrix. Permethrin-specific molecularly imprinted polymer (MIP) solid-phase extraction cartridges were developed for use as a sample preparation technique for a composite food matrix. Vortexing with acetonitrile and centrifugation were found to provide optimal extraction of the permethrin isomers from the composite foods. The acetonitrile (with 1% acetic acid) was mostly evaporated and the analytes reconstituted in 90:10 water/acetonitrile in preparation for molecularly imprinted solid-phase extraction. Permethrin elution was accomplished with acetonitrile and sample extracts were analyzed by isotope dilution gas chromatography–ion trap mass spectrometry. Quantitation of product ions provided definitive identification of the pesticide isomers. The final method parameters were tested with fortified composite food samples of varying fat content (1%, 5%, and 10%) and recoveries ranged from 99.3% to 126%. Vegetable samples with incurred pesticide levels were also analyzed with the given method and recoveries were acceptable (81.0–95.7%). Method detection limits were demonstrated in the low ppb range. Finally, the applicability of the MIP stationary phase to extract other pyrethroids, specifically cyfluthrin and cypermethrin, was also investigated.     

Experimental and computational investigation of Au25 clusters and CO2: a unique interaction and enhanced electrocatalytic activity

Atomically precise, inherently charged Au(25) clusters are an exciting prospect for promoting catalytically challenging reactions, and we have studied the interaction between CO(2) and Au(25). Experimental results indicate a reversible Au(25)-CO(2) interaction that produced spectroscopic and electrochemical changes similar to those seen with cluster oxidation. Density functional theory (DFT) modeling indicates these changes stem from a CO(2)-induced redistribution of charge within the cluster. Identification of this spontaneous coupling led to the application of Au(25) as a catalyst for the electrochemical reduction of CO(2) in aqueous media. Au(25) promoted the CO(2) → CO reaction within 90 mV of the formal potential (thermodynamic limit), representing an approximate 200-300 mV improvement over larger Au nanoparticles and bulk Au. Peak CO(2) conversion occurred at -1 V (vs RHE) with approximately 100% efficiency and a rate 7-700 times higher than that for larger Au catalysts and 10-100 times higher than those for current state-of-the-art processes.