Supramolecular design of a porphyrin-[60]fullerene photocurrent generation system on a DNA scaffold fabricated by a conjugate polymer film

DNA which binds monocationic [60]fullerene (1) and tetracationic porphyrin (TMPyP) was readily fabricated by electrochemical oxidative polymerization of 3.4-ethylenedioxythiophene (EDOT) and the resultant poly(EDOT) composite was deposited on an ITO electrode as a stable thin film. Spectral and CV analyses established that one 1 and one TMPyP are bound per 57 nucleobase units, that is, every three pitches of DNA. Photoirradiation of this 1/TMPyP/DNA-poly(EDOT) film generated a photocurrent in 3.8% quantum yield, which was much higher than those obtained from 1/DNA and TMPyP/DNA systems. One can conclude, therefore that the photoexcited energy of TMPyP is transferred to 1, which is collected by the electron-conducting poly(EDOT) film. The present paper shows that DNA is useful as a scaffold to arrange redox-active couples in a one-dimensional matrix.     

Synthesis of novel cyclic sulfilimines, 2-azathiabenzene derivatives

The synthesis and some properties of novel cyclic sulfilimines, 2-methyl-1-aza-2-thianaphthalene and 9-methyl-10-aza-9-thiaphenanthrene are described.     

Preparation of functionally Pegylated gold nanoparticles with narrow distribution through autoreduction of auric cation by alpha-biotinyl-PEG-block-[poly(2- (N,N-dimethylamino)ethyl methacrylate)

PEGylated gold nanoparticles with biotin moieties installed at the distal end of the PEG tethered chains were prepared by the autoreduction of HAuCl4 catalyzed by alpha-biotinyl-PEG-block-poly[2-(N,N-dimethylamino)ethyl methacrylate] (biotinyl-PEG/PAMA) in aqueous medium at room temperature. The size of the gold nanoparticles was controllable in a range of 6-13 nm by changing the initial Au3+/polymer ratio, while retaining their narrow size distribution. The dispersion stability of the nanoparticles in aqueous medium was extremely high even under the condition of salt concentration as high as I = 2.0. Biotinyl-PEG/PAMA-anchored gold nanoparticles underwent specific aggregation in the presence of streptavidin, revealing their promising utility as colloidal sensing systems applicable under biological condition.     

Development of novel diastereoselective alkenylation of enolates using alkenylselenonium salts

[reaction: see text] A novel alkenylation of enolates using alkenylselenonium salts is described. A reaction of lithium enolates, which were prepared in situ by the reaction of LiHMDS and carbonyl compounds, with alkenylselenonium salts gave the ethenylation products of carbonyl compounds in high yield. Diastereoselective alkenylation was also accomplished by the reaction of the enolates derived from N-acyl-1,3-oxazolidin-2-ones with the alkenylselenonium salt to afford good results (up to 92% yield and up to 95% de).     

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).     

One-pot preparation of mono-dispersed and physiologically stabilized gold colloid

We have developed a rapid and simple method for the preparation of nearly mono-dispersed gold colloids with a fairly high concentration above 10 mM using hydroxylamine as the reducing agents, in the presence of α-methoxy-ω-mercaptoethyl-poly(ethylene glycol)(MeO-PEG-SH). It was found that a hydroxylamine acted not only as a reducing agent, but also as a nucleation agent under alkaline reaction conditions. Though the colloid concentration was fairly high, the dispersion stability was remarkably improved even in a high ionic strength in the range greater than 1 M NaCl, in which conventional citrate gold colloids immediately flocculate and precipitate. The obtained colloid was successfully re-dispersed in aqueous media after lyophilization. In addition, the prepared gold colloid reduced a protein adsorption significantly on its surface. Concerning these results, the obtained colloidal dispersion may be suitable for biological applications, since a regionally concentrated colloidal dispersion with dispersion stability is required for bio-labeling and bio-imaging systems.Electronic Supplementary Material Supplementary material is available for this article at     

Inhibitors of nitric oxide production from the rhizomes of Alpinia galanga: structures of new 8-9' linked neolignans and sesquineolignan

The 80% aqueous acetone extract from the rhizomes of Alpinia galanga showed nitric oxide (NO) production inhibitory activities in mouse peritoneal macrophages. From the aqueous acetone extract, three new 8-9' linked neolignans, galanganal, galanganols A and B, and a sesquineolignan, galanganol C, were isolated together with nine known phenylpropanoids and p-hydroxybenzaldehyde. The structures of new neolignans were determined on the basis of physicochemical and chemical evidence. In addition, the inhibitory effects of the constituents from the rhizomes of A. galanga on NO production induced by lipopolysaccharide in mouse peritoneal macrophages were examined. Among them, galanganal (IC50=68 microM), galanganols B (88 microM) and C (33 microM), 1'S-1'-acetoxychavicol acetate (2.3 microM), 1'S-1'-acetoxyeugenol acetate (11 microM), trans-p-hydroxycinnamaldehyde (ca. 20 microM), trans-p-coumaryl alcohol (72 microM), and trans-p-coumaryl diacetate (19 microM) were found to show inhibitory activity.     

'Nucleo-nanocages': designed ternary oligodeoxyribonucleotides spontaneously form nanosized DNA cages

DNA three-way junctions formed from three 30-mer oligonucleotides that contain single-chained self-complementary sticky ends spontaneously self-assemble into 'nucleo-nanocages': the exo- and endo-nuclease digestion experiments indicate that defects such as the single and double strand end structures are absent on the spherical nano-assemblies, providing clear evidence for the closed nanocage structure.     

Separation of stereoisomers of several furan derivatives by capillary gas chromatography-mass spectrometry,supercritical fluid chromatography,and liquid chromatography using chiral stationary phases

The direct separation of several stereoisomers (enantiomers and geometrical isomers) of furan derivatives, important intermediates for the synthesis of physiologically active natural products, was achieved using capillary gas chromatography/mass spectrometry with a per-O-methyl-beta-cyclodextrin, supercritical fluid chromatography and high-performance liquid chromatography with a tris(3,5-dimethylphenylcarbamate) of cellulose or amylose for the chiral stational phases, respectively. The temperature dependence of the peak resolution (Rs) and the retention factor (k) over the range of 110-130 degrees was studied using crotyl furfuryl ether in gas chromatography. Successive increases in the Rs value and of the difference between the k value of the E-isomer and the k value of the Z-isomer were observed when the gradient temperature was decreased. The per-O-methyl-beta-cyclodextrin column was suitable for use with volatile furan ethers whose molecular masses are between 150 and 180. In conclusion, the separation of thermally unstable furan derivatives was accomplished using supercritical fluid chromatography and high-performance liquid chromatography.