Individual variation in the pup attraction call produced by female Australian fur seals during early lactation

Otariid seals (fur seals and sea lions) are colonial breeders with large numbers of females giving birth on land during a synchronous breeding period. Once pups are born, females alternate between feeding their young ashore and foraging at sea. Upon return, both mother and pup must relocate each other and it is thought to be primarily facilitated by vocal recognition. Vocalizations of thirteen female Australian fur seals (Arctocephalus pusillus doriferus) were recorded during the breeding seasons of December 2000 and 2001, when pups are aged from newborns to one month. The pup attraction call was examined to determine whether females produce individually distinct calls which could be used by pups as a basis for vocal recognition. Potential for individual coding, discriminant function analysis (DFA), and classification and regression tree analysis were used to determine which call features were important in separating individuals. Using the results from all three analyses: F0, MIN F and DUR were considered important in separating individuals. In 76% of cases, the PAC was classified to the correct caller, using DFA, suggesting that there is sufficient stereotypy within individual calls, and sufficient variation between them, to enable vocal recognition by pups of this species.     

Balanced Cayley graphs and balanced planar graphs

A balanced graph is a bipartite graph with no induced circuit of length . These graphs arise in integer linear programming. We focus on graph-algebraic properties of balanced graphs to prove a complete classification of balanced Cayley graphs on abelian groups. Moreover, in this paper, we prove that there is no cubic balanced planar graph. Finally, some remarkable conjectures for balanced regular graphs are also presented. The graphs in this paper are simple.     

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.     

Evaluation of preprocessing steps to compensate for magnetic field distortions due to body movements in BOLD fMRI

Blood oxygenation level-dependent (BOLD) functional magnetic resonance imaging (fMRI) is currently the dominant technique for non-invasive investigation of brain functions. One of the challenges with BOLD fMRI, particularly at high fields, is compensation for the effects of spatiotemporally varying magnetic field inhomogeneities (ΔB₀) caused by normal subject respiration and, in some studies, movement of the subject during the scan to perform tasks related to the functional paradigm. The presence of ΔB₀ during data acquisition distorts reconstructed images and introduces extraneous fluctuations in the fMRI time series that decrease the BOLD contrast-to-noise ratio. Optimization of the fMRI data-processing pipeline to compensate for geometric distortions is of paramount importance to ensure high quality of fMRI data. To investigate ΔB₀ caused by subject movement, echo-planar imaging scans were collected with and without concurrent motion of a phantom arm. The phantom arm was constructed and moved by the experimenter to emulate forearm motions while subjects remained still and observed a visual stimulation paradigm. These data were then subjected to eight different combinations of preprocessing steps. The best preprocessing pipeline included navigator correction, a complex phase regressor and spatial smoothing. The synergy between navigator correction and phase regression reduced geometric distortions better than either step in isolation and preconditioned the data to make them more amenable to the benefits of spatial smoothing. The combination of these steps provided a 10% increase in t-statistics compared to only navigator correction and spatial smoothing and reduced the noise and false activations in regions where no legitimate effects would occur.     

Finite size effects on the structural and magnetic properties of sol–gel synthesized NiFe2O4 powders

Nanoparticles of nickel ferrite have been synthesized by the sol–gel method and the effect of grain size on its structural and magnetic properties have been studied in detail. X-ray diffraction (XRD) studies revealed that all the samples are single phasic possessing the inverse spinel structure. Grain size of the sol–gel synthesized powders has been determined from the XRD data and the strain graph. A grain size of 9 nm was observed for the as prepared powders of NiFe₂O₄ obtained through the sol–gel method. It was also observed that strain was induced during the firing process. Magnetization measurements have been carried out on all the samples prepared in the present series. It was found that the specific magnetization of the nanosized NiFe₂O₄ powders was lower than that of the corresponding coarse-grained counterparts and decreased with a decrease in grain size. The coercivity of the sol–gel synthesized NiFe₂O₄ nanoparticles attained a maximum value when the grain size was 15 nm and then decreased as the grain size was increased further.     

Simplified Fast Transient Control in Coolerless Pump EDFA for Metro Applications

A novel optical transient suppression technique to dramatically reduce gain variation of EDFA with un-cooled pump is demonstrated experimentally, showing excellent performance of 50μs transient time with no more than 0.5dB excursion and 0.25dB offset.     

Metal-insulator crossover in high T c cuprates: A gauge field approach

A metal-insulator crossover appears in the experimental data for in-plane resistivity of underdoped cuprates and a range of superconducting cuprates in the presence of a strong magnetic field suppressing superconductivity. We propose an explanation for this phenomenon based on a gauge field theory approach to the t-J model. In this approach, based on a formal spin-charge separation, the low energy effective action describes gapful spinons (with a theoretically derived doping dependence of the gap m _s ² ∼ δ| ln δ|) and holons with finite Fermi surface (ɛF ∼ tδ) interacting via a gauge field whose basic effect on the spinons is to bind them into overdamped spin waves, shifting their gap by a damping term linear in T, which causes the metal-insulator crossover. The presence of a magnetic field perpendicular to the plane acts by increasing the damping, in turn producing a big positive transverse in-plane magnetoresistance at low T, as experimentally observed.