The ionization constants of alpha-alanine in NaCl at 25 degrees. Effect of the ionic strength based on three models

In the present work we obtained the experimental pKs of the amino acid alpha-alanine in NaCl at 25 degrees and different ionic strengths. The equilibrium constants have been potentiometrically determined with a commercial glass electrode and the results analysed through three models: two directly based on the Pitzer and Scatchard approaches to the ion specific interaction theory and the other based on a simpler modification of the Debye-Hückel equation. The three models fit the data reasonably well and the extrapolated pK values obtained show a good agreement. The goodness of the ridge regression method cannot be probed in this case.     

Seed gum ofStryphnodendron barbatiman (barbatimão)

Stryphnodendron barbatiman (barbatimão) is a native tree that is found throughout the “Cerrados,” a region of Central Brazil. Plant seeds, on water extraction, furnished 28 g% galactomannan (dryweight basis), the monosaccharide composition of which (galactose to mannose ratio, 1.0:1.5) fits in the legume heteromannan group. This seed gum, after Sevag deproteinization, still retained 6 g% of associated protein and had a molecular weight of about 1.8 MD on gel filtration. A high intrinsic viscosity (1300 cP) was observed for the polysaccharide sample obtained after reflux of the crushed seeds in 80% aqueous methanol.

     

Comparison of chemical properties of food products processed by conventional and ohmic heating

The effect of ohmic and conventional heat processing of different food products on their chemical and physical parameters was studied. Depending on the food being analysed, parameters such as pH, total solids, ash, titratable acidity, ascorbic acid, total sugars, total fatty acids, total phenolic compounds, and anthocyanins content were determined before and after ohmic and conventional pasteurization techniques and the results were compared using one-way analysis of variance. In goat milk samples treated by ohmic technology the pH value (6.58) and total fatty acids content in milk fat (86.5 mass %) were comparable to those found in milk treated by conventional process, however, ohmically treated samples presented a lower content of lactic acid, 0.13 %. In cloudberry jam samples treated by ohmic technology the results of some of the main parameters tested, such as total sugar content 46.1 mass %, ascorbic acid content 2.83 mass %, and titratable acidity 6.01 mass % (as citric acid) did not show significant differences when compared with samples treated by conventional technology. Presented at the 33rd International Conference of the Slovak Society of Chemical Engineering, Tatranské Matliare, 22–26 May 2006.     

Characterization and complementation of a Pichia stipitis mutant unable to grow on d-xylose or l-arabinose

Pichia stipitis CBS 6054 will grow on d-xylose, d-arabinose, and l-arabinose. d-Xylose and l-arabinose are abundant in seed hulls of maize, and their utilization is important in processing grain residues. To elucidate the degradation pathway for l-arabinose, we obtained a mutant, FPL-MY30, that was unable to grow on d-xylose and l-arabinose but that could grow on d-arabinitol. Activity assays of oxidoreductase and pentulokinase enzymes involved in d-xylose, d-arabinose, and l-arabinose pathways indicated that FPL-MY30 is deficient in d-xylitol dehydrogenase (D-XDH), d- and l-arabinitol dehydrogenases, and d-ribitol dehydrogenase. Transforming FPL-MY30 with a gene for xylitol dehydrogenase (PsXYL2), which was cloned from CBS 6054 (Gen Bank AF127801), restored the D-XDH activity and the capacity for FPL-MY30 to grow on l-arabinose. This suggested that FPL-MY30 is critically deficient in XYL2 and that the d-xylose and l-arabinose metabolic pathways have xylitolas a common intermediate. The capacity for FPL-MY30 to grow on d-arabinitol could proceed through d-ribulose.     

Single-step preparation and catalytic activity of mesoporous MCM-41 and SBA-15 silicas functionalized with perfluoroalkylsulfonic acid groups analogous to Nafion

Preparation of hybrid organic-inorganic MCM-41 and SBA-15 silicas functionalized with perfluoroalkylsulfonic acid groups has been achieved in a single step by reacting the mesoporous silicas with 1,2,2-trifluoro-2-hydroxy-1-trifluoromethylethane sulfonic acid beta-sultone; the catalysts showed higher activity than commercial Nafion-silica composite for the esterification of long chain fatty acids with ethanol.     

Oriented immobilization of Desulfovibrio gigas hydrogenase onto carbon electrodes by covalent bonds for nonmediated oxidation of H2

The orientation of hydrogenase bound covalently to a pyrolytic graphite edge electrode modified with a 4-aminophenyl monolayer can be modulated via electrostatic interactions during the immobilization step. At low ionic strength and when the amino groups of the electrode surface are mostly protonated, the hydrogenase is immobilized with the negatively charged region that surrounds its 4Fe4S cluster nearer to the protein surface facing the electrode. This allows direct electron transfer between the immobilized hydrogenase and the electrode, which is observed by the strong catalytic currents measured in the presence of the H2 substrate. Therefore, a very stable enzymatic electrode is produced that catalyzes nonmediated H2 oxidation.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

Effect of ionic strength on the formal potential of the glass electrode in various saline media

We examined the variation with ionic strength (I, adjusted with KCl, KNO₃, KBr, NaCl or NaClO₄) of the formal potential (E_const) for glass electrodes exhibiting a Nernstian response (i.e. E_cell=E_const−s log [H⁺]). For this purpose, we investigated the different factors included in the formal potential, so we obtained reported values for the liquid junction potential as a function of ionic strength and determined the logarithm of the activity coefficient for the proton in various saline media, using Pitzer equations.     

Metabonomics: the use of electrospray mass spectrometry coupled to reversed-phase liquid chromatography shows potential for the screening of rat urine in drug development

The application of liquid chromatography/mass spectrometry (LC/MS) followed by principal components analysis (PCA) has been successfully applied to the screening of rat urine following the administration of three candidate pharmaceuticals. With this methodology it was possible to differentiate the control samples from the dosed samples and to identify the components of the mass spectrum responsible for the separation. These data clearly show that LC/MS is a viable alternative, or complementary, technique to proton NMR for metabonomics applications in drug discovery and development.