A general stereoselective method for the synthesis of cyclopropanecarboxylates. A new version of the homologous Horner-Wadsworth-Emmons reaction

The synthesis of alpha-, beta- and gamma-substituted alpha-phosphono-gamma-lactones was accomplished using different ring closure and ring homologation strategies. It was found that the lactones could be selectively transformed into the corresponding ethyl cyclopropanecarboxylates by treatment with sodium ethoxide in boiling THF. The reported reaction provides an attractive alternative to the classical homologous Horner-Wadsworth-Emmons approach to the construction of cyclopropanes with electron-withdrawing functionalities.     

The 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleosides in the solid-phase synthesis of oligoribonucleotides

Emerging RNA-based technologies for controlling gene expression have triggered a high demand for synthetic oligoribonucleotides and have motivated the development of ribonucleoside phosphoramidites that would exhibit coupling kinetics and coupling efficiencies comparable to those of deoxyribonucleoside phosphoramidites. To fulfill these needs, the novel 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl group for 2'-hydroxyl protection of ribonucleoside phosphoramidites 9a-d has been implemented (Schemes 1 and 2). The solid-phase synthesis of AUCCGUAGCUAACGUCAUGG was then carried out employing 9a-d as 0.2 M solutions in dry MeCN and 5-benzylthio-1H-tetrazole as an activator. The coupling efficiency of 9a-d averaged 99% within a coupling time of 180 s. Following removal of all base-sensitive protecting groups, cleavage of the remaining 2'-[4-(N-methylamino)benzyl] acetals from the RNA oligonucleotide was effected in buffered 0.1 M AcOH (pH 3.8) within 30 min at 90 degrees C. RP-HPLC and PAGE analyses of the fully deprotected AUCCGUAGCUAACGUCAUGG were comparable to those of a commercial RNA oligonucleotide sharing an identical sequence. Enzymatic digestion of the RNA oligomer catalyzed by bovine spleen phosphodiesterase and bacterial alkaline phosphatase revealed no significant amounts of RNA fragments containing (2'-->5')-internucleotidic phosphodiester linkages or noteworthy nucleobase modifications.     

The case for the intermediacy of monomeric metaphosphate analogues during oxidation of H-phosphonothioate, H-phosphonodithioate, and H-phosphonoselenoate monoesters: mechanistic and synthetic studies

Studies on the reaction of H-phosphonothioate, H-phosphonodithioate, and H-phosphonoselenoate monoesters with iodine in the presence of a base led to identification of a unique oxidation pathway, which consists of the initial oxidation of the sulfur or selenium atom in these compounds, followed by oxidative elimination of hydrogen iodide to generate the corresponding metaphosphate analogues. The intermediacy of the latter species during oxidation of the investigated H-phosphonate monoester derivatives with iodine was supported by various diagnostic experiments. The scope and limitation of these oxidative transformations for the purpose of the synthesis of nucleoside phosphorothioate, nucleoside phosphorodithioate, and nucleoside phosphoroselenoate diesters was also investigated.     

Theoretical studies on the mechanism of C-P bond cleavage of a model alpha-aminophosphonate in acidic condition

Various reaction paths of the P-C bond cleavage of alpha-aminophosphonates in acidic media, resulting in the derivatives of phosphonic acid, has been investigated using density functional level of theories in the gas phase as well as in aqueous medium. Dimethyl (alpha-anilinobenzyl)phosphonate has been used as the model molecule and our investigation confirms a three steps process including protonation, P-C bond cleavage, and the transformation of the products from the final transition state (imine cation and H-phosphonate) through hydrolysis. The most favorable reaction path starts from the amino group protonation, followed by a proton transfer through N-H...O(P) hydrogen bond, and the P-C bond cleavage from the resulting protonated structure. Explicit inclusion of water molecules indicated that two waters are needed for the P-C bond cleavage, and the calculated mechanistic paths in this hydrated model are similar to those of the aqueous solvation model.     

Ab initio prediction of the potential energy surface and vibration-rotation energy levels of CaCl2

The equilibrium structure and potential energy surface of calcium dichloride (CaCl2) have been determined from accurate ab initio calculations using the coupled-cluster method, CCSD(T), in conjunction with basis sets of quadruple- and quintuple-zeta quality. The CaCl2 molecule was found to be linear at equilibrium. The vibration-rotation energy levels of various CaCl2 isotopomers were predicted by the variational method. The calculated spectroscopic constants could be used to guide future high-resolution spectroscopic experiments on calcium dichloride.     

AFM studies of solid-supported lipid bilayers formed at a Au(111) electrode surface using vesicle fusion and a combination of Langmuir-Blodgett and Langmuir-Schaefer techniques

Atomic force microscopy (AFM) has been used to characterize the formation of a phospholipid bilayer composed of 1,2-dimyristyl-sn-glycero-3-phosphocholine (DMPC) at a Au(111) electrode surface. The bilayer was formed by one of two methods: fusion of lamellar vesicles or by the combination of Langmuir-Blodgett (LB) and Langmuir-Schaefer (LS) deposition. Results indicate that phospholipid vesicles rapidly adsorb and fuse to form a film at the electrode surface. The resulting film undergoes a very slow structural transformation until a characteristic corrugated phase is formed. Force-distance curve measurements reveal that the thickness of the corrugated phase is consistent with the thickness of a bilayer lipid membrane. The formation of the corrugated phase may be explained by considering the elastic properties of the film and taking into account spontaneous curvature induced by the asymmetric environment of the bilayer, in which one side faces the gold substrate and the other side faces the solution. The effect of temperature and electrode potential on the stability of the corrugated phase has also been described.     

The properties of gold catalysts precursors adsorbed on the MCM-41 materials modified with Mn and Fe oxides

Silica mesoporous materials modified with manganese and iron were obtained by the hydrothermal method. Gold was introduced to pure and modified silica materials by the direct hydrothermal and impregnation methods. Nitrogen adsorption/desorption studies evidenced formation of the materials with large total surface area and mesoporous structure. Unmodified silica materials showed regular pore arrangement. The uniform porous structure was distorted in the iron or manganese containing samples. XRD, UV-Vis/DRS spectroscopy and temperature programmed reduction studies revealed changes of the nature of transition metal oxide and gold species on the different preparation stages. The oxide species after drying were strongly dispersed and partially incorporated to the silica framework. High temperature treatment led to the formation of extraframework Mn and Fe oxide species. Complex processes of gold deposition were observed during hydrothermal synthesis and impregnation of modified silica materials. The increase of the size of gold species was observed during calcination. The presence of transition metal oxides decreased sintering of gold crystallites.     

Quantitative conformational study of redox-active [2]rotaxanes, part 1: Methodology and application to a model [2]rotaxane

This paper reports a novel methodology for the conformational analysis of [2]rotaxanes. It combines NMR spectroscopic (COSY, NOESY and the recently reported paramagnetic line-broadening and suppression technique) and electrochemical techniques to enable a quantitative analysis of the co-conformations of interlocked molecules and the conformations of their components. This methodology was used to study a model [2]rotaxane in solution. This [2]rotaxane consists of an axle that incorporates an electron-poor, doubly positively charged viologen that threads an electron-rich crown ether. It has been shown that the axle of the [2]rotaxane in its dicationic state adopts a folded conformation in solution and the crown ether is localised at the viologen moiety. Following a one-electron reduction of viologen, the paramagnetic radical cation of the [2]rotaxane retains its folded conformation in solution. The data also demonstrate that in the radical cation the crown ether remains localised at the viologen, despite its reduced affinity for the singly reduced viologen. The combined quantitative NMR spectroscopic and electrochemical characterisation of the electromechanical function of the model [2]rotaxane in solution provides an important reference point for the study of switching in structurally related bistable [2]rotaxanes, which is the subject of the second part of this work.     

Ultrafast carbene-carbene isomerization

The photochemistry of two isomeric aryl diazo ketones was investigated by fs time-resolved UV-vis and IR spectroscopies. Both diazo ketone excited states decompose in less than 300 fs by multiple pathways. One pathway involves concerted Wolff rearrangement and nitrogen extrusion, most likely in the syn rotomer. In the anti rotomer of one isomer, oxygen migration proceeds in concert with nitrogen extrusion to form rearranged keto carbene. This rotomer excited state also decomposes to form unrearranged carbene, which isomerizes in 5 ps.     

STM studies of fusion of cholesterol suspensions and mixed 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC)/cholesterol vesicles onto a Au(111) electrode surface

Electrochemical scanning tunneling microscopy (EC-STM) has been applied to study the structure of the film formed by fusion of cholesterol suspensions and mixed dimyristoylphosphatidylcholine (DMPC)/cholesterol vesicles on a Au(111) electrode surface. It has been demonstrated that cholesterol molecules assemble at the gold support into several structures templated by the crystallography of the metal surface and involving flat or edge-on adsorbed molecules. Studies of the film formed by fusion of mixed DMPC/cholesterol vesicles revealed that ordered domains of either pure DMPC or pure cholesterol were formed. These results indicate that, at the metal surface, the molecules released by the rupture of a vesicle initially self-assemble into a well-ordered monolayer. The self-assembly is controlled by the hydrocarbon skeleton-metal surface interaction. In the case of mixed DMPC/cholesterol vesicles, the molecule-metal interactions induce segregation of the two components into single component domains. However, the molecule-metal interaction induced monolayer is a transient phenomenon. When more molecules accumulate at the surface, the molecule-molecule interactions dominate the assembly, and the monolayer is transformed into a bilayer.