Extremality and the global Markov property II: The global markov property for non-FKG maximal Gibbs measures

We give a condition on a Gibbs measure for an attractive Markov specification, which assures extremality and the global Markov property. As an example of application we consider the class of attractive Markov specifications defined on a compact configuration space over a two-dimensional lattice by the interaction Hamiltonians (assumed to have a finite set of periodic ground configurations) satisfying Peierl's condition. We prove that each extremal Gibbs measure for such a specification, at sufficiently low temperature, has the global Markov property.On leave of absence from the Institute of Theoretical Physics, University of Wrocaw, Poland.     

Ab initio study of the NMR shielding constants and spin-spin coupling constants in cyclopropene

Summary Ab initio calculations of parameters which characterize the NMR spectrum are presented for the cyclopropene molecule. The London orbitals CHF (or GIAO-CHF, Gauge-Independent Atomic Orbital Coupled Hartree-Fock) results for the shielding constants are in good agreement with the experimental data, accurately determined, and with otherab initio values. The calculations of the NMR spin-spin coupling constants have been performed using the Multiconfiguration Time-Dependent Hartree-Fock (MC TDHF) approach. Different basis sets and MC SCF wavefunctions were used to estimate the accuracy of the results. Good agreement is obtained with the coupling constants estimated using the available experimental data.Dedicated to Professor Werner Kutzelnigg on the occasion of his 60th birthday     

Intra- and intermolecular fluorescence quenching in 7-(pyridyl)indoles

Three isomeric 7-(pyridyl)indoles reveal very different, solvent-dependent photophysical properties. Due to rapid excited state depopulation involving intramolecular hydrogen bonding, 7-(2′-pyridyl)indole is practically nonfluorescent at room temperature. In nonpolar and polar aprotic solvents, 7-(3′-pyridyl)indole and 7-(4′-pyridyl)indole fluorescence strongly, but the emission is quenched in alcohols. Syn and anti rotameric forms of 7-(3′-pyridyl)indole are detected, each quenched to a different degree. This differential quenching is interpreted as evidence of enhanced S₁ → S₀ internal conversion being more efficient in cyclic solvates, with alcohol molecules forming a bridge between the proton donor and acceptor groups of an excited chromophore.     

9-acetoxyanthracene derivatives. Part VIII. The mechanism of degradation of 9-acetoxy-10-arylanthracenes to anthraquinone

The mechanism of degradation of 9-acetoxy-10-arylanthracenes to anthraquinose with the use of HNO₃ in AcOH has been reported. This was proved by way of example on 9-acetoxy-10-(4′-acetoxyphenyl )anthracene (1) by means of separation and identification of intermediate products $\text{2}$, $\text{3}$ and $\text{4}$.     

Structural assignment of organotin hydrides containing the oxazoline ligand

A series of triorganotin hydrides and diorganotin dihydrides containing the optically active 2-(4-isopropyl-2-oxazolinyl)-5-phenyl ligand have been characterized by means of the multinuclear low-temperature NMR investigations, the results of which are discussed. In the corresponding organotin hydrides values of the ¹J(¹H-^117/119Sn) couplings appeared to be temperature dependent, supporting an axial/equatorial position of the hydrogen attached to the tin.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

DELAYED EMISSION OF CHLOROPHYLL a AGGREGATES AND RHODAMINE 6G EMBEDDED IN POLYMER MATRIX*

Delayed luminescence (in the microsecond time range) of the chlorophyll (Chl) a“dry” form as well as hydrated dimers located in a polyvinylalcohol film was measured from room temperature down to 8 K. In the same matrix the delayed luminescence of rhodamine 6G (Rhod) was investigated. The delayed emission both of Chl a and Rhod is probably due to the formation and delayed recombination of a radical pair. It seems that this process occurs without participation of triplet states, as it does not reflect their well-known sensitivity to oxygen. The temperature dependence of the delayed luminescence of vanous Chl forms is different. In the region around 678 nm (dry monomer) delayed luminescence needs a thermal activation energy of about 0.03 eV, whereas at 740 nm (wet aggregates) delayed luminescence intensity increases linearly with decreasing temperature. Its assignment as a-type delayed luminescence from the low-lying triplet state can consistently be excluded from both the weak temperature dependence of the delayed fluorescence and its large intensity as compared to the prompt fluorescence. Delayed luminescence of Rhod is almost independent of temperature between 8 K and 300 K. The dependence of delayed luminescence intensity on exciting light intensity is linear at lower intensities and tends to saturation at higher. Therefore the delayed luminescence is not related to exciton annihilation. Positions and intensities of the Chl delayed luminescence bands show that it is not phosphorescence (β-type delayed luminescence). The aggregation of both Chl and Rhod molecules strongly influences delayed luminescence since it differs in several properties if excited in the monomer or in the aggregate absorption range. Every aggregational form of dye emits its characteristic delayed luminescence band.     

Synthesis of Functionalized (2-Thienylcarbonyl)thiazoles and 4-(2-Thienyl)pyridines by Reaction of (2-Thienylcarbonyl)thioacetanilides and their Enamine Derivatives

Summary. The condensation of two molecules of 2-(2-thienylcarbonyl)thioacetanilides catalyzed by piperidine yielded thiazole derivatives as confirmed by X-ray crystal structure analysis. The reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid thioanilides furnished 6-amino-1-aryl-4-(2-thienyl)-1,2-dihydro-2-thioxopyridine-5-carbonitriles. A similar reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid anilides provided 2-oxopyridine-5-carbonitriles.     

Synthesis and characterization of metal polycarboxylates constructed from lanthanides(iii) and 1,2,4,5-benzenetetracarboxylic acid

The complexes of yttrium(III) and lanthanides(III) with 1,2,4,5-benzenetetracarboxylic acid were prepared as crystalline solids of the general formula Ln₄(C₁₀H₂O₈)₃⋅14H₂O. They are insoluble in water. On heating in air or inert gas atmosphere all compounds lose water molecules; next anhydrous compounds decompose to oxides. The yttrium complex and heavy lanthanide (from Ho to Lu) ones crystallize in monoclinic crystal system. The dehydration does not change the crystal structure of the compounds.     

Effect of the fibre-forming material structure and silica nanoparticles

The paper discusses the thermal properties of alginate fibres made from alginic acid or sodium alginate and from alginates substituted with divalent metal ions during the fibre-forming stage. Alginate fibres with an addition of silica nanoparticles have also been examined. The selection of fibre-forming parameters was intended to obtain the best either sorption or strength properties depending on the specific fibre application. Thermal curves of the fibres under investigations obtained by under air atmosphere and differential scanning calorimetry (DSC) under neutral gas atmosphere have been interpreted from the view of physical and chemical changes in the fibre-forming material. Based on thermogravimetric curves, the fibre thermal stability indices have been determined. It has been found that the addition of silica nanoparticles exerts a positive influence on the thermal properties of the examined fibres.