Domain-wall energy in sintered Nd15Fe77B8 permanent magnet

From measurements of the magnetic domain widthsD versus grain thicknessL, we have determined the domain wall energy in the demagnetized state for a sintered Nd₁₅Fe₇₇B₈ magnet: = 56 erg/cm². Using this wall energy and the published magnetocry-stalline constantK ₁=4.9×10⁷ erg/cm³, we have calculated the exchange constantA=4.0×10^–6 erg/cm, domain wall thickness _B=89 Å, and the critical diameter for single domain particlesD _c=0.67 m.     

Intra- and intermolecular fluorescence quenching in 7-(pyridyl)indoles

Three isomeric 7-(pyridyl)indoles reveal very different, solvent-dependent photophysical properties. Due to rapid excited state depopulation involving intramolecular hydrogen bonding, 7-(2′-pyridyl)indole is practically nonfluorescent at room temperature. In nonpolar and polar aprotic solvents, 7-(3′-pyridyl)indole and 7-(4′-pyridyl)indole fluorescence strongly, but the emission is quenched in alcohols. Syn and anti rotameric forms of 7-(3′-pyridyl)indole are detected, each quenched to a different degree. This differential quenching is interpreted as evidence of enhanced S₁ → S₀ internal conversion being more efficient in cyclic solvates, with alcohol molecules forming a bridge between the proton donor and acceptor groups of an excited chromophore.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

DELAYED EMISSION OF CHLOROPHYLL a AGGREGATES AND RHODAMINE 6G EMBEDDED IN POLYMER MATRIX*

Delayed luminescence (in the microsecond time range) of the chlorophyll (Chl) a“dry” form as well as hydrated dimers located in a polyvinylalcohol film was measured from room temperature down to 8 K. In the same matrix the delayed luminescence of rhodamine 6G (Rhod) was investigated. The delayed emission both of Chl a and Rhod is probably due to the formation and delayed recombination of a radical pair. It seems that this process occurs without participation of triplet states, as it does not reflect their well-known sensitivity to oxygen. The temperature dependence of the delayed luminescence of vanous Chl forms is different. In the region around 678 nm (dry monomer) delayed luminescence needs a thermal activation energy of about 0.03 eV, whereas at 740 nm (wet aggregates) delayed luminescence intensity increases linearly with decreasing temperature. Its assignment as a-type delayed luminescence from the low-lying triplet state can consistently be excluded from both the weak temperature dependence of the delayed fluorescence and its large intensity as compared to the prompt fluorescence. Delayed luminescence of Rhod is almost independent of temperature between 8 K and 300 K. The dependence of delayed luminescence intensity on exciting light intensity is linear at lower intensities and tends to saturation at higher. Therefore the delayed luminescence is not related to exciton annihilation. Positions and intensities of the Chl delayed luminescence bands show that it is not phosphorescence (β-type delayed luminescence). The aggregation of both Chl and Rhod molecules strongly influences delayed luminescence since it differs in several properties if excited in the monomer or in the aggregate absorption range. Every aggregational form of dye emits its characteristic delayed luminescence band.     

Synthesis of Functionalized (2-Thienylcarbonyl)thiazoles and 4-(2-Thienyl)pyridines by Reaction of (2-Thienylcarbonyl)thioacetanilides and their Enamine Derivatives

Summary. The condensation of two molecules of 2-(2-thienylcarbonyl)thioacetanilides catalyzed by piperidine yielded thiazole derivatives as confirmed by X-ray crystal structure analysis. The reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid thioanilides furnished 6-amino-1-aryl-4-(2-thienyl)-1,2-dihydro-2-thioxopyridine-5-carbonitriles. A similar reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid anilides provided 2-oxopyridine-5-carbonitriles.     

Synthesis and characterization of metal polycarboxylates constructed from lanthanides(iii) and 1,2,4,5-benzenetetracarboxylic acid

The complexes of yttrium(III) and lanthanides(III) with 1,2,4,5-benzenetetracarboxylic acid were prepared as crystalline solids of the general formula Ln₄(C₁₀H₂O₈)₃⋅14H₂O. They are insoluble in water. On heating in air or inert gas atmosphere all compounds lose water molecules; next anhydrous compounds decompose to oxides. The yttrium complex and heavy lanthanide (from Ho to Lu) ones crystallize in monoclinic crystal system. The dehydration does not change the crystal structure of the compounds.     

Effect of the fibre-forming material structure and silica nanoparticles

The paper discusses the thermal properties of alginate fibres made from alginic acid or sodium alginate and from alginates substituted with divalent metal ions during the fibre-forming stage. Alginate fibres with an addition of silica nanoparticles have also been examined. The selection of fibre-forming parameters was intended to obtain the best either sorption or strength properties depending on the specific fibre application. Thermal curves of the fibres under investigations obtained by under air atmosphere and differential scanning calorimetry (DSC) under neutral gas atmosphere have been interpreted from the view of physical and chemical changes in the fibre-forming material. Based on thermogravimetric curves, the fibre thermal stability indices have been determined. It has been found that the addition of silica nanoparticles exerts a positive influence on the thermal properties of the examined fibres.     

Electron-stimulated desorption from ionic crystal surfaces

Inelastic interactions of electrons with surfaces of ionic crystals result in emission of various particles such as ions, atoms and molecules. We will review such electron-stimulated desorption processes for the particular class of ionic crystals, namely for alkali halides. In this case, a dominant fraction of the emission is in the form of halogen and alkali atoms characterized by a thermal (Maxwellian) spectrum of translational energies. For several alkali halides (potassium and rubidium chlorides, bromides, and iodides), however, a significant part of the halogen atoms is ejected with nonthermal energies, i.e. energies of the order of 0.1 eV. The results of recent systematic studies of angular-resolved kinetic energy distributions of the emitted particles will be reported and current views on the electronic mechanisms of desorption will be described. In particular, it will be shown that the ESD mechanism can be understood in terms of the model involving a surface localisation of the so called “hot-holes” created by electron bombardment of alkali halides. A role of hot holes in ESD processes will further be discussed in relation to very recent experimental results obtained for the KBr crystals doped with In impurities which act as efficient hole traps.     

Photogeneration and quenching of reactive oxygen species by urocanic acid

Urocanic acid, UCA, is characterized by two electronic transitions in the UV-B (280-320 nm) which comprise its broad absorption spectrum and give rise to wavelength-dependent isomerization quantum yields. The absorption spectrum of UCA extends into the UV-A (320-400 nm). Given the UV-A component of sunlight is significantly greater than the UV-B component it is hypothesized even weak UV-A photochemistry of UCA could be important for in vivo responses to UV radiation. Degenerate pump-probe experiments performed on t-UCA at several wavelengths in the UV-A reveal an excited-state absorption that undergoes a rapid, approximately 1 ps decay. Photoacoustic experiments performed on both the cis and trans isomers reveal the formation of a long-lived intermediate following UV-A excitation. The efficiency and action spectra for this latter photoactive process are presented and are similar for both isomers of UCA. Cholesterol hydroperoxide assays designed to investigate the nature of the UV-A photoreactivity of t-UCA confirm the production of reactive oxygen species. The bimolecular rate constant for the quenching of singlet oxygen by t-UCA is determined to be 3.5 x 10(6) M(-1) s(-1). Taking into consideration recent theoretical calculations and jet expansion studies of the electronic structure of gas-phase t-UCA, a model is proposed to explain the isomerization and photoreactivity of t-UCA in solution over the UV-A region.     

Coherent effects in energy transport in model dendritic structures investigated by ultrafast fluorescence anisotropy spectroscopy

Measurements of ultrafast fluorescence anisotropy decay in model branched dendritic molecules of different symmetry are reported. These molecules contain the fundamental branching center units of larger dendrimer macromolecules with either three (C(3))- or four (T(d), tetrahedral)-fold symmetry. The anisotropy for a tetrahedral system is found to decay on a subpicosecond time scale (880 fs). This decay can be qualitatively explained by F?rster-type incoherent energy migration between chromophores. Alternatively, for a nitrogen-centered trimer system, the fluorescence anisotropy decay time (35 fs) is found to be much shorter than that of the tetramers, and the decay cannot be attributed to an incoherent hopping mechanism. In this case, a coherent interchromophore energy transport mechanism should be considered. The mechanism of the ultrafast energy migration process in the branched systems is interpreted by use of a phenomenological quantum mechanical model, which examines the two extreme cases of incoherent and coherent interactions.