Luminescence Properties of Tb-Doped Yttrium Disilicate Prepared by the Sol–Gel Method

A sol–gel method for the synthesis of nanosized powders of yttrium disilicate doped with Tb^{3 +} is presented. The influence of grain size and annealing temperature on the structure and luminescence properties of the materials obtained has been investigated. The preparation of glass-ceramic composite has been also described. The effect of incorporating the nanocrystals into sol–gel silica glasses on their physicochemical properties has been shown and discussed. A lack of influence of the annealing above 1300°C on the lifetimes measured for the nanocrystals embedded in the glass, as compared to the Y₂Si₂O₇:Tb^{3 +} powders, has been observed.     

The Effect of Cyclodextrins on the Photochemical Stability of 7-Amino-4-methylcoumarin in Aqueous Solution

The effect of -, - and -cyclodextrin onthe photochemical stability of 7-amino-4-methylcoumarin (C120)was studied. Using spectroscopic techniques (UV/Vis absorption spectroscopy, fluorescence, fluorescence anisotropy and circular dichroism) combined with HPLC/MS and MS analysis it was demonstrated that addition of -cyclodextrin to the aqueoussolution of C120 markedly inhibits the photodegradation of that dye. This results from theformation of an inclusion complex between C120 and -cyclodextrin.     

The Monte-Carlo model of a light-emitting diode

The first complete Monte-Carlo model of a surface light-emitting diode is presented in this paper. In the model all important phenomena (including the two-dimensional diffusion of minority carriers before their recombination in the active region and the re-emission of radiation) are taken into account. The influence of various construction parameters on the external quantum efficiency of the homojunction GaAs diode is examined.     

On a two-velocity model of the Boltzmann-Enskog equation

Summary A simple two-velocity model (-model)of the Boltzmann-Enskog equation for a gas of hard spheres is proposed. Physical properties of such a model are analyzed and its differences with respect to the Carleman model are investigated. Global existence theorems and some qualitative properties of solutions of the -model are also proved.On leave from Dept. of Mathematics and Mechanics, University of Warsaw, Poland.     

Thermal decomposition of Cd(CH3COO)2·2H2O studied by a coupled TG-DTA-MS method

The thermal decomposition of cadmium acetate dihydrate in helium and in air atmosphere has been investigated by means of a coupled TG-DTA-MS method combined with X-ray diffraction analysis. Dehydration of Cd(CH₃COO)₂·2H₂O is a two-stage process with Cd(CH₃COO)₂·H₂O as intermediate. The way of Cd(CH₃COO)₂ decomposition strongly depends on the surrounding gas atmosphere and the rate of heating. CdO, acetone and CO₂ are the primary products of decomposition in air. In helium decomposition goes by two parallel and consecutive reactions in which intermediates, Cd and CdCO₃, are formed. Metallic cadmium oxidizes and cadmium carbonate decomposes giving CdO. Some of the metallic cadmium, depending on the heating rate and the concentration of oxygen, evaporates. Acetone is partially oxidized in secondary reactions with oxygen. This revised version was published online in July 2006 with corrections to the Cover Date.     

Domain-wall energy in sintered Nd15Fe77B8 permanent magnet

From measurements of the magnetic domain widthsD versus grain thicknessL, we have determined the domain wall energy in the demagnetized state for a sintered Nd₁₅Fe₇₇B₈ magnet: = 56 erg/cm². Using this wall energy and the published magnetocry-stalline constantK ₁=4.9×10⁷ erg/cm³, we have calculated the exchange constantA=4.0×10^–6 erg/cm, domain wall thickness _B=89 Å, and the critical diameter for single domain particlesD _c=0.67 m.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

DELAYED EMISSION OF CHLOROPHYLL a AGGREGATES AND RHODAMINE 6G EMBEDDED IN POLYMER MATRIX*

Delayed luminescence (in the microsecond time range) of the chlorophyll (Chl) a“dry” form as well as hydrated dimers located in a polyvinylalcohol film was measured from room temperature down to 8 K. In the same matrix the delayed luminescence of rhodamine 6G (Rhod) was investigated. The delayed emission both of Chl a and Rhod is probably due to the formation and delayed recombination of a radical pair. It seems that this process occurs without participation of triplet states, as it does not reflect their well-known sensitivity to oxygen. The temperature dependence of the delayed luminescence of vanous Chl forms is different. In the region around 678 nm (dry monomer) delayed luminescence needs a thermal activation energy of about 0.03 eV, whereas at 740 nm (wet aggregates) delayed luminescence intensity increases linearly with decreasing temperature. Its assignment as a-type delayed luminescence from the low-lying triplet state can consistently be excluded from both the weak temperature dependence of the delayed fluorescence and its large intensity as compared to the prompt fluorescence. Delayed luminescence of Rhod is almost independent of temperature between 8 K and 300 K. The dependence of delayed luminescence intensity on exciting light intensity is linear at lower intensities and tends to saturation at higher. Therefore the delayed luminescence is not related to exciton annihilation. Positions and intensities of the Chl delayed luminescence bands show that it is not phosphorescence (β-type delayed luminescence). The aggregation of both Chl and Rhod molecules strongly influences delayed luminescence since it differs in several properties if excited in the monomer or in the aggregate absorption range. Every aggregational form of dye emits its characteristic delayed luminescence band.