2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

DELAYED EMISSION OF CHLOROPHYLL a AGGREGATES AND RHODAMINE 6G EMBEDDED IN POLYMER MATRIX*

Delayed luminescence (in the microsecond time range) of the chlorophyll (Chl) a“dry” form as well as hydrated dimers located in a polyvinylalcohol film was measured from room temperature down to 8 K. In the same matrix the delayed luminescence of rhodamine 6G (Rhod) was investigated. The delayed emission both of Chl a and Rhod is probably due to the formation and delayed recombination of a radical pair. It seems that this process occurs without participation of triplet states, as it does not reflect their well-known sensitivity to oxygen. The temperature dependence of the delayed luminescence of vanous Chl forms is different. In the region around 678 nm (dry monomer) delayed luminescence needs a thermal activation energy of about 0.03 eV, whereas at 740 nm (wet aggregates) delayed luminescence intensity increases linearly with decreasing temperature. Its assignment as a-type delayed luminescence from the low-lying triplet state can consistently be excluded from both the weak temperature dependence of the delayed fluorescence and its large intensity as compared to the prompt fluorescence. Delayed luminescence of Rhod is almost independent of temperature between 8 K and 300 K. The dependence of delayed luminescence intensity on exciting light intensity is linear at lower intensities and tends to saturation at higher. Therefore the delayed luminescence is not related to exciton annihilation. Positions and intensities of the Chl delayed luminescence bands show that it is not phosphorescence (β-type delayed luminescence). The aggregation of both Chl and Rhod molecules strongly influences delayed luminescence since it differs in several properties if excited in the monomer or in the aggregate absorption range. Every aggregational form of dye emits its characteristic delayed luminescence band.     

Synthesis of Functionalized (2-Thienylcarbonyl)thiazoles and 4-(2-Thienyl)pyridines by Reaction of (2-Thienylcarbonyl)thioacetanilides and their Enamine Derivatives

Summary. The condensation of two molecules of 2-(2-thienylcarbonyl)thioacetanilides catalyzed by piperidine yielded thiazole derivatives as confirmed by X-ray crystal structure analysis. The reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid thioanilides furnished 6-amino-1-aryl-4-(2-thienyl)-1,2-dihydro-2-thioxopyridine-5-carbonitriles. A similar reaction of malononitrile with 3-morpholino-3-(2-thienyl)acrylic acid anilides provided 2-oxopyridine-5-carbonitriles.     

A new convenient synthesis of N-acyl-2-(dimethoxyphosphoryl)glycinates

Easily accessible N-acyl-2-triphenylphosphonioglycinate tetrafluoroborates react smoothly with trimethylphosphite in the presence of methyltriphenylphosphonium iodide to give N-acyl-2-(dimethoxyphosphoryl)glycinates in good or very good yields. The dimethoxyphosphorylglycinates may be isolated by column chromatography, or used directly for the Wadsworth-Emmons synthesis of α,β-dehydro-α-amino acids in a one-pot procedure without purification.     

Electron-stimulated desorption from ionic crystal surfaces

Inelastic interactions of electrons with surfaces of ionic crystals result in emission of various particles such as ions, atoms and molecules. We will review such electron-stimulated desorption processes for the particular class of ionic crystals, namely for alkali halides. In this case, a dominant fraction of the emission is in the form of halogen and alkali atoms characterized by a thermal (Maxwellian) spectrum of translational energies. For several alkali halides (potassium and rubidium chlorides, bromides, and iodides), however, a significant part of the halogen atoms is ejected with nonthermal energies, i.e. energies of the order of 0.1 eV. The results of recent systematic studies of angular-resolved kinetic energy distributions of the emitted particles will be reported and current views on the electronic mechanisms of desorption will be described. In particular, it will be shown that the ESD mechanism can be understood in terms of the model involving a surface localisation of the so called “hot-holes” created by electron bombardment of alkali halides. A role of hot holes in ESD processes will further be discussed in relation to very recent experimental results obtained for the KBr crystals doped with In impurities which act as efficient hole traps.     

Coherent effects in energy transport in model dendritic structures investigated by ultrafast fluorescence anisotropy spectroscopy

Measurements of ultrafast fluorescence anisotropy decay in model branched dendritic molecules of different symmetry are reported. These molecules contain the fundamental branching center units of larger dendrimer macromolecules with either three (C(3))- or four (T(d), tetrahedral)-fold symmetry. The anisotropy for a tetrahedral system is found to decay on a subpicosecond time scale (880 fs). This decay can be qualitatively explained by F?rster-type incoherent energy migration between chromophores. Alternatively, for a nitrogen-centered trimer system, the fluorescence anisotropy decay time (35 fs) is found to be much shorter than that of the tetramers, and the decay cannot be attributed to an incoherent hopping mechanism. In this case, a coherent interchromophore energy transport mechanism should be considered. The mechanism of the ultrafast energy migration process in the branched systems is interpreted by use of a phenomenological quantum mechanical model, which examines the two extreme cases of incoherent and coherent interactions.     

The convenient route to cd fragment for the synthesis of vitamin D3 relatives

The efficient degradation of $\text{1}$ to the α-methylene ketone $\text{4}$ is described. Compound $\text{4}$ was then converted to the allylic alcohol $\text{8a}$ - the precursor of vitamin D³ relatives.     

Strukturelle Untersuchungen einiger neutraler Komplexe des zweiwertigen Molybdäns

Unit cell parameters have been calculated from x-ray powder diffraction data of Mo₂Br₄ Py ₄ (A), Mo₂I₄ Py ₄ (B), Mo₂I₄ Pic ₄ (C), Mo₂(SCN)₄ Py ₄ (D) and Mo₂(SCN)₄ Pic ₄ (E), A, B and C crystallize tetragonal. A witha=9,4₂,c=15,O₂ Å; B witha=9,4₆,c=14,9₈ Å and C witha=9,6₆ andc=15,7₂ Å D and E crystallize orthorhombic. D witha=10,0₉,b=9,1₄,c=15,0₈ Å; E witha=10,2₂,b=9,4₁ andc=15,1₅ Å.Py=pyridine,Pic=4-methylpyridine.

     

Tetraphenylporphyrins monosubstituted with a crown ether in one phenyl ring. Synthesis and characterization

Summary The synthesis and spectroscopic characterization of seven new tetraphenyl-porphyrins (1–7) derivatized with 12-crown-4, 14-crown-4, 15-crown-5, or 18-crown-6 ether units inortho orpara position of one of the phenyl rings is described.

---

In einem Phenylring mit Kronenethern monosubstituierte Tetraphenylporphyrine. Synthese und Charakterisierung

Zusammenfassung Die Synthese und die spektroskopische Charakterisierung sieben neuer Tetraphenylporphyrine (1–7), die mit 12-Krone-4, 14-Krone-4, 15-Krone-5 oder 18-Krone-6 in derortho-oderpara-Position eines Phenylrings substituiert sind, werden beschrieben.

     

The IINS, IR and DFT studies of hydrogen bonds in 6-Furfuryl and 6-Benzylaminopurines

FTIR and IINS spectra of 6-Furfurylaminopurine (6-FAP) and 6-Benzylaminopurine (6-BAP) taken at different temperatures have been analysed and compared with the spectra calculated by the ab initio DFT/B3LYP method and the semiempirical PM3 method in the isolated molecule approximation, for the tautomers N3-H, N7-H and N9-H, and dimers with hydrogen bonds. For 6-FAP the best agreement between the calculated and experimental (at 20 K) spectra has been found for the N9-H tautomer, whose structure was established by X-ray diffraction. For 6-BAP the analogous agreement for the N9-H tautomer structure has been poor and much better for the N7-H tautomer. The vibrational spectra calculated for dimers of the molecules studied involved in hydrogen bonds, permitted also an interpretation of the bands whose positions and FWHM in the FTIR spectra changed with temperature.