On a two-velocity model of the Boltzmann-Enskog equation

Summary A simple two-velocity model (-model)of the Boltzmann-Enskog equation for a gas of hard spheres is proposed. Physical properties of such a model are analyzed and its differences with respect to the Carleman model are investigated. Global existence theorems and some qualitative properties of solutions of the -model are also proved.On leave from Dept. of Mathematics and Mechanics, University of Warsaw, Poland.     

Thermal decomposition of Cd(CH3COO)2·2H2O studied by a coupled TG-DTA-MS method

The thermal decomposition of cadmium acetate dihydrate in helium and in air atmosphere has been investigated by means of a coupled TG-DTA-MS method combined with X-ray diffraction analysis. Dehydration of Cd(CH₃COO)₂·2H₂O is a two-stage process with Cd(CH₃COO)₂·H₂O as intermediate. The way of Cd(CH₃COO)₂ decomposition strongly depends on the surrounding gas atmosphere and the rate of heating. CdO, acetone and CO₂ are the primary products of decomposition in air. In helium decomposition goes by two parallel and consecutive reactions in which intermediates, Cd and CdCO₃, are formed. Metallic cadmium oxidizes and cadmium carbonate decomposes giving CdO. Some of the metallic cadmium, depending on the heating rate and the concentration of oxygen, evaporates. Acetone is partially oxidized in secondary reactions with oxygen. This revised version was published online in July 2006 with corrections to the Cover Date.     

Domain-wall energy in sintered Nd15Fe77B8 permanent magnet

From measurements of the magnetic domain widthsD versus grain thicknessL, we have determined the domain wall energy in the demagnetized state for a sintered Nd₁₅Fe₇₇B₈ magnet: = 56 erg/cm². Using this wall energy and the published magnetocry-stalline constantK ₁=4.9×10⁷ erg/cm³, we have calculated the exchange constantA=4.0×10^–6 erg/cm, domain wall thickness _B=89 Å, and the critical diameter for single domain particlesD _c=0.67 m.     

2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of deoxyribonucleoside phosphoramidites in the solid-phase preparation of DNA oligonucleotides

Several nitrogen-sulfur reagents have been investigated as potential 5'-hydroxyl protecting groups for deoxyribonucleoside phosphoramidites to improve the synthesis of oligonucleotides on glass microarrays. Out of the nitrogen-sulfur-based protecting groups so far investigated, the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group exhibited near optimal properties for 5'-hydroxyl protection by virtue of the mildness of its deprotection conditions. Specifically, the iterative cleavage of a terminal 5'-sulfamidite group in the synthesis of 5'-d(ATCCGTAGCCAAGGTCATGT) on controlled-pore glass is efficiently accomplished by treatment with iodine in the presence of an acidic salt. Hydrolysis of the oligonucleotide to its 2'-deoxyribonucleosides upon exposure to snake venom phosphodiesterase and bacterial alkaline phosphatase did not reveal the formation of any nucleobase adducts or other modifications. These findings indicate that the 2,2,5,5-tetramethylpyrrolidin-3-one-1-sulfinyl group for 5'-hydroxyl protection of phosphoramidites, such as 10a-d, may lead to the production of oligonucleotide microarrays exhibiting enhanced specificity and sensitivity in the detection of nucleic acid targets.     

DELAYED EMISSION OF CHLOROPHYLL a AGGREGATES AND RHODAMINE 6G EMBEDDED IN POLYMER MATRIX*

Delayed luminescence (in the microsecond time range) of the chlorophyll (Chl) a“dry” form as well as hydrated dimers located in a polyvinylalcohol film was measured from room temperature down to 8 K. In the same matrix the delayed luminescence of rhodamine 6G (Rhod) was investigated. The delayed emission both of Chl a and Rhod is probably due to the formation and delayed recombination of a radical pair. It seems that this process occurs without participation of triplet states, as it does not reflect their well-known sensitivity to oxygen. The temperature dependence of the delayed luminescence of vanous Chl forms is different. In the region around 678 nm (dry monomer) delayed luminescence needs a thermal activation energy of about 0.03 eV, whereas at 740 nm (wet aggregates) delayed luminescence intensity increases linearly with decreasing temperature. Its assignment as a-type delayed luminescence from the low-lying triplet state can consistently be excluded from both the weak temperature dependence of the delayed fluorescence and its large intensity as compared to the prompt fluorescence. Delayed luminescence of Rhod is almost independent of temperature between 8 K and 300 K. The dependence of delayed luminescence intensity on exciting light intensity is linear at lower intensities and tends to saturation at higher. Therefore the delayed luminescence is not related to exciton annihilation. Positions and intensities of the Chl delayed luminescence bands show that it is not phosphorescence (β-type delayed luminescence). The aggregation of both Chl and Rhod molecules strongly influences delayed luminescence since it differs in several properties if excited in the monomer or in the aggregate absorption range. Every aggregational form of dye emits its characteristic delayed luminescence band.     

Photogeneration and quenching of reactive oxygen species by urocanic acid

Urocanic acid, UCA, is characterized by two electronic transitions in the UV-B (280-320 nm) which comprise its broad absorption spectrum and give rise to wavelength-dependent isomerization quantum yields. The absorption spectrum of UCA extends into the UV-A (320-400 nm). Given the UV-A component of sunlight is significantly greater than the UV-B component it is hypothesized even weak UV-A photochemistry of UCA could be important for in vivo responses to UV radiation. Degenerate pump-probe experiments performed on t-UCA at several wavelengths in the UV-A reveal an excited-state absorption that undergoes a rapid, approximately 1 ps decay. Photoacoustic experiments performed on both the cis and trans isomers reveal the formation of a long-lived intermediate following UV-A excitation. The efficiency and action spectra for this latter photoactive process are presented and are similar for both isomers of UCA. Cholesterol hydroperoxide assays designed to investigate the nature of the UV-A photoreactivity of t-UCA confirm the production of reactive oxygen species. The bimolecular rate constant for the quenching of singlet oxygen by t-UCA is determined to be 3.5 x 10(6) M(-1) s(-1). Taking into consideration recent theoretical calculations and jet expansion studies of the electronic structure of gas-phase t-UCA, a model is proposed to explain the isomerization and photoreactivity of t-UCA in solution over the UV-A region.     

Coherent effects in energy transport in model dendritic structures investigated by ultrafast fluorescence anisotropy spectroscopy

Measurements of ultrafast fluorescence anisotropy decay in model branched dendritic molecules of different symmetry are reported. These molecules contain the fundamental branching center units of larger dendrimer macromolecules with either three (C(3))- or four (T(d), tetrahedral)-fold symmetry. The anisotropy for a tetrahedral system is found to decay on a subpicosecond time scale (880 fs). This decay can be qualitatively explained by F?rster-type incoherent energy migration between chromophores. Alternatively, for a nitrogen-centered trimer system, the fluorescence anisotropy decay time (35 fs) is found to be much shorter than that of the tetramers, and the decay cannot be attributed to an incoherent hopping mechanism. In this case, a coherent interchromophore energy transport mechanism should be considered. The mechanism of the ultrafast energy migration process in the branched systems is interpreted by use of a phenomenological quantum mechanical model, which examines the two extreme cases of incoherent and coherent interactions.     

The polymorphic transformations of cobalt molybdate

Polymorphic transformations of CoMoO₄ were studied by means of high temperature X-ray measurements within the temperature range 25–1200°C. On heating phase a obtained from low temperature modification b a new modification a′ was discovered. Phase a obtained by thermal decomposition of solvated α-CoMoO₄ shows different behaviour. At 700–930°C depending on the conditions of preparation it transforms irreversibly into still another modification a″. On cooling, a mixture of phases a + a″ is obtained, the presence of a″ being responsible for the explosionwise transition into b, observed around the room temperature.     

Prediction of adsorption of organic component and water vapour mixture onto activated carbon

A simple isotherm equation is derived for the adsorption of an organic component onto activated carbon in presence of water vapour. The theoretical results are compared with experimental data for toluene-water vapour-activated carbon, which were published byRipperger andGermerdonk [10].

---

Vorhersage der Adsorption einer organischen Komponente und Wasserdampf an Aktivkohle

Zusammenfassung Es wird eine einfache Adsorptionsisotherme abgeleitet, welche die gleichzeitige Adsorption eines organischen Stoffes und Wasser an Aktivkohle beschreibt. Die theoretischen Ergebnisse werden mit experimentellen Resultaten vonRipperger undGermerdonk [10] für Toluol-Wasser-Aktivkohle verglichen.

---

Symbols a _i adsorbate concentration in adsorbent, kg/kg of carbon - a _0i monolayer capacity, kg/kg of carbon - b _i kinetic parameter of theLangmuir equation - E _j adsorption energy in thej-th layer - i i-th component (1 — water vapour, 2 — organic compound) - j j-th layer - m number of layers - n number of adsorbed components - p partial pressure, Pa - p* saturation partial pressure, Pa - p _C water vapour partial pressure at begining of capillary condensation, Pa - surface coverage