Kinetic and mechanistic study of the quasiliving cationic polymerization of styrene with the 2-phenyl-2-propanol/AlCl3 · OBu2 initiating system

The cationic polymerization of styrene with the 2-phenyl-2-propanol (CumOH)/AlCl₃ · OBu₂ initiating system at various dibutyl ether concentrations in a mixture of 1,2-dichloroethane and n-hexane (55:45 v/v) at −15 °C was investigated. The experimental results showed that an increase in dibutyl ether concentration leads to a noticeable decrease in the polymerization rate as well as to the more controlled polymerization in terms of molecular weight (M_n) and molecular weight distribution (MWD) evolutions. The kinetic investigation revealed that the polymerization proceeds in two stages. The first stage is characterized by high polymerization rate and slow initiation relative to propagation. During this stage molecular weight decreases or does not change and MWD increases with conversion. In the second stage considerably slower quasiliving polymerization of styrene occurs. The quasiliving nature of the styrene polymerization by the CumOH/AlCl₃ · OBu₂ system is proved and mechanistic scheme of the polymerization is proposed.     

Oxidation of bridging groups by carboxylate coordinated ligands in palladium clusters

Thermolysis of tetranuclear palladium clusters Pd₄(-Q)₄ Pd₄(-Q)₄(-O₂CR)₄ (Q=CPh₂ or CO;R=Me, CMe₃, Ph, CH₂Cl or CF₃) has been found to involve innersphere oxidation of carbene or carbonyl ligands during which an oxygen atom transfer occurs from the carboxylate group to the carbene or carbonyl ligand. The thermolysis of the carbonyl clusters gives rise to the products of CO₂ insertion into the C–H bond of benzene or toluene used as solvents forming benzoic acid from benzene and a mixture of phenylacetic and toluic acids from toluene. The reaction of [Pd(OAc)₂(PPh₃)]₂ with HCO₂H includes the transfer of an O atom from formate ligand to the P atom and cleavage of the P-Ph bond accompanied by transfer of the Ph group from PPh₃ ligand to the palladium atom. The structure of the complex formed, [Pd(-O₂PPh₂)(C₆H₅)(PPh₃)]₂, has been resolved by X-ray analysis.     

Synthese und Kristallstruktur von Bis(1,2-dimethyl-5-nitro-imidazol)dichlorocobalt(II)

Synthesis and Crystal Structure of Bis(1,2-dimetyl-5-nitro-imidazole)dichlorocobalt(II) Bis(1,2-dimethyl-5-nitro-imidazol)dichlorocobalt(II) was obtained by reaction of CoCl₂ · 6 H₂O with 1,2-dimethyl-5-nitro-imidazole in methanol. The compound forms blue crystals which were characterized by IR and UV-vis spectroscopy and by an X-ray crystal structure determination. Co(C₅H₇N₃O₂)₂Cl₂: tetragonal, space group I4 2d, Z = 8, a = 1142.1(1) pm, c = 2577.3(2) pm. R = 0.036 for 670 independent reflexions. The Co atom is tetrahedrally surrounded by two chlorine and two N atoms at distances of 222.8(2) and 203.5(4) pm.     

Synthesis of the first kinetically stable dibenzosilafulvene

The first stable dibenzosilafulvene, 9-{[8-(dimethylaminomethyl)-1-naphthyl]phenylsil-1-ylium}fluoren-9-ide (7a), was obtained in one step from 9-fluorenyllithium and chloro[8-(dimethylaminomethyl)-1-naphthyl]phenylsilane as a stable solvate with THF. The structure of the zwitterionic compound7a was established by¹H,¹³C, and²⁹Si NMR in solution and in the solid state. The reactions of compound7a with crotonaldehyde, ethanol, and triethylethylidenephosphorane are described. The data on the synthesis of alkoxy- and alkylthiochloro-9-fluorenylsilanes and their phosphonium salts are given. Translated fromIzvestiya Akademii Nauk. Seriya Khimicheskaya, No. 3, pp. 486–491, March, 1998.     

Synthesis and binding affinities of novel SRIF-mimicking beta-D-glucosides satisfying the requirement for a pi-cloud at C1

[reaction: see text] The synthesis of four bioactive analogues of the somatostatin (SRIF-14) mimetic, beta-d-glucoside (+)-2, in which the C1 indole side chain is replaced with indole surrogates, has been achieved. These congeners, possessing the naphthyl, benzothiophene, benzyl, and benzofuran substituents, were predicted to satisfy the electrostatic requirements of the tryptophan binding pocket of SRIF. Unlike the previously described C4 picolyl and pyrazinyl congeners, these ligands bind the hSST4 receptor.     

Synthesis and immobilization of quaternary ammonium cations in acidic zeolites

A general method for the synthesis of quaternary ammonium cations in acidic zeolites by a direct reaction of tertiary amines and alcohols is described.     

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

Platinum nanoparticles generated in functionality-enhanced reaction media based on polyoctadecylsiloxane with long-chain functional modifiers

Functionality-enhanced nanostructured matrices generated by intercalating polyoctadecylsiloxane (PODS) with octadecene (ODC) or octadecylamine (ODA) are employed as reaction media in which to grow Pt nanoparticles. Small-angle X-ray scattering (SAXS) signatures confirm that the amphiphilic PODS matrix orders into lamellae with a periodicity (d) of 5.24 nm, which corresponds to the siloxy bilayer and a double layer of alkyl tails. The regular packing of the hydrophobic tails becomes distorted upon introduction of ODC or ODA. Incorporation of K[(C2H4)PtCl3].H2O (a Zeise salt) into the PODS/ODC matrix, followed by reduction of the Pt ions by NaBH4 or H2, results in the localization of Pt compounds and nanoparticles along the siloxy bilayers, which remain dimensionally unchanged. Electron density profiles deduced from PODS/ODA, however, provide evidence for considerable structural reorganization upon metalation with H2PtCl6.6H2O. In this case, the siloxy bilayers broaden due to the presence of PtCl62- ions, and the hydrophobic layers become distorted due to the formation of (PtCl62-)(ODAH+)2 complexes. Subsequent reduction by NaBH4 restores the inherent PODS organization, while H2 reduction partially preserves the distorted matrix, indicating that some Pt nanoparticles form in close proximity to the siloxy bilayer. Transmission electron microscopy reveals that relatively monodisperse Pt nanoparticles measuring approximately 1 nm in diameter are located along the siloxy bilayers, whereas anomalous SAXS further indicates that nanoparticles form aggregates of comparable size to d within the PODS double layers.     

Evaluation of cellulase preparations for hydrolysis of hardwood substrates

Seven cellulase preparations from Penicillium and Trichoderma spp. were evaluated for their ability to hydrolyze the cellulose fraction of hardwoods (yellow poplar and red maple) pretreated by organosolv extraction, as well as model cellulosic substrates such as filter paper. There was no significant correlation among hydrolytic performance on pretreated hardwood, based on glucose release, and filter paper activity. However, performance on pretreated hardwood showed significant correlations to the levels of endogenous β-glucosidase and xylanase activities in the cellulase preparation. Accordingly, differences in performance were reduced or eliminated following supplementation with a crude β-glucosidase preparation containing both activities. These results complement a previous investigation using softwoods pretreated by either organosolv extraction or steam explosion. Cellulase preparations that performed best on hardwood also showed superior performance on the softwood substrates.     

Core-shell nanostructures from single poly(N-vinylcaprolactam) macromolecules: stabilization and visualization

Formation of core-shell poly(N-vinylcaprolactam) (PVCL) single-molecule nanostructures due to interaction of PVCL with metal ions was studied using transmission electron microscopy, 13C NMR, and light scattering. This study demonstrates that addition of CoCl2 to PVCL in its globular conformation yields unimolecular core-shell polymer particles with the core decorated with Co(II) ions. The crucial condition for formation of well-defined unimolecular nanostructures is the presence of stable globular aggregates in aqueous solution. Moreover, the metal ions should have a sufficiently high coordination number (higher than 2) to provide a cross-linking and stabilization of the core.