Synthesis and binding affinities of novel SRIF-mimicking beta-D-glucosides satisfying the requirement for a pi-cloud at C1

[reaction: see text] The synthesis of four bioactive analogues of the somatostatin (SRIF-14) mimetic, beta-d-glucoside (+)-2, in which the C1 indole side chain is replaced with indole surrogates, has been achieved. These congeners, possessing the naphthyl, benzothiophene, benzyl, and benzofuran substituents, were predicted to satisfy the electrostatic requirements of the tryptophan binding pocket of SRIF. Unlike the previously described C4 picolyl and pyrazinyl congeners, these ligands bind the hSST4 receptor.     

Synthesis and immobilization of quaternary ammonium cations in acidic zeolites

A general method for the synthesis of quaternary ammonium cations in acidic zeolites by a direct reaction of tertiary amines and alcohols is described.     

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

Platinum nanoparticles generated in functionality-enhanced reaction media based on polyoctadecylsiloxane with long-chain functional modifiers

Functionality-enhanced nanostructured matrices generated by intercalating polyoctadecylsiloxane (PODS) with octadecene (ODC) or octadecylamine (ODA) are employed as reaction media in which to grow Pt nanoparticles. Small-angle X-ray scattering (SAXS) signatures confirm that the amphiphilic PODS matrix orders into lamellae with a periodicity (d) of 5.24 nm, which corresponds to the siloxy bilayer and a double layer of alkyl tails. The regular packing of the hydrophobic tails becomes distorted upon introduction of ODC or ODA. Incorporation of K[(C2H4)PtCl3].H2O (a Zeise salt) into the PODS/ODC matrix, followed by reduction of the Pt ions by NaBH4 or H2, results in the localization of Pt compounds and nanoparticles along the siloxy bilayers, which remain dimensionally unchanged. Electron density profiles deduced from PODS/ODA, however, provide evidence for considerable structural reorganization upon metalation with H2PtCl6.6H2O. In this case, the siloxy bilayers broaden due to the presence of PtCl62- ions, and the hydrophobic layers become distorted due to the formation of (PtCl62-)(ODAH+)2 complexes. Subsequent reduction by NaBH4 restores the inherent PODS organization, while H2 reduction partially preserves the distorted matrix, indicating that some Pt nanoparticles form in close proximity to the siloxy bilayer. Transmission electron microscopy reveals that relatively monodisperse Pt nanoparticles measuring approximately 1 nm in diameter are located along the siloxy bilayers, whereas anomalous SAXS further indicates that nanoparticles form aggregates of comparable size to d within the PODS double layers.     

Evaluation of cellulase preparations for hydrolysis of hardwood substrates

Seven cellulase preparations from Penicillium and Trichoderma spp. were evaluated for their ability to hydrolyze the cellulose fraction of hardwoods (yellow poplar and red maple) pretreated by organosolv extraction, as well as model cellulosic substrates such as filter paper. There was no significant correlation among hydrolytic performance on pretreated hardwood, based on glucose release, and filter paper activity. However, performance on pretreated hardwood showed significant correlations to the levels of endogenous β-glucosidase and xylanase activities in the cellulase preparation. Accordingly, differences in performance were reduced or eliminated following supplementation with a crude β-glucosidase preparation containing both activities. These results complement a previous investigation using softwoods pretreated by either organosolv extraction or steam explosion. Cellulase preparations that performed best on hardwood also showed superior performance on the softwood substrates.     

Core-shell nanostructures from single poly(N-vinylcaprolactam) macromolecules: stabilization and visualization

Formation of core-shell poly(N-vinylcaprolactam) (PVCL) single-molecule nanostructures due to interaction of PVCL with metal ions was studied using transmission electron microscopy, 13C NMR, and light scattering. This study demonstrates that addition of CoCl2 to PVCL in its globular conformation yields unimolecular core-shell polymer particles with the core decorated with Co(II) ions. The crucial condition for formation of well-defined unimolecular nanostructures is the presence of stable globular aggregates in aqueous solution. Moreover, the metal ions should have a sufficiently high coordination number (higher than 2) to provide a cross-linking and stabilization of the core.     

Electron solvation by highly polar molecules: density functional theory study of atomic sodium interaction with water, ammonia, and methanol

This study further extends the scope of a previous paper [Y. Ferro and A. Allouche, J. Chem. Phys. 118, 10461 (2003)] on the reactivity of atomic Na with water to some other highly polar molecules known for their solvation properties connected to efficient hydrogen bonding. The solvation mechanisms of ammonia and methanol are compared to the hydration mechanism. It is shown that in the case of ammonia, the stability of the solvated system is only ensured by electrostatic interactions, whereas the methanol action is more similar to that of water. More specific attention is given to the solvation process of the valence 3s Na electron. The consequences on the chemical reactivity are analyzed: Whereas ammonia is nonreactive when interacting with atomic sodium, two chemical reactions are proposed for methanol. The first process is dehydrogenation and yields methoxy species and hydrogen. The other one is dehydration and the final products are methoxy species, but also methyl radical and water. The respective roles of electron solvation and hydrogen bonds network are analyzed in detail in view of the density of states of the reactive systems.     

Reactions of 4,7‐dihydro‐1,2,4‐triazolo[1,5‐a]pyrimidines with α,β‐unsaturated carbonyl compounds

The reaction of 5,7‐diphenyl‐4,7‐dihydro‐1,2,4‐triazolo[1,5‐a]pyrimidine ( 1 ) with α,β‐unsaturated carbonyl compounds 2a‐f led to the formation of the alkylated heterocycles 3a‐f (Figure 1). However, the reaction of 5‐methyl‐7‐phenyl‐4,7‐dihydro‐1,2,4‐triazolo[1,5‐a]pyrimidine ( 5 ) with 2a‐c yielded under the same conditions the triazolo[5,1‐b]quinazolines 6a‐c (Figure 3). In this case, the alkylation is followed by a cyclocondensation. The structure elucidation of the products is based on ir, ms, ¹H and ¹³C nmr measurements and on an X‐ray diffraction study.     

Thermal behavior of polyacrylonitrile polymers synthesized under different conditions and comonomer compositions

Polyacrylonitrile (PAN) polymers are used as precursors for carbon fiber production. This process requires an oxidative stabilization step, which can be studied by differential scanning calorimetry (DSC). In this sense, thermal behavior of PAN based terpolymers by different polymerization processes, compositions and itaconic acid concentrations in the reaction media were investigated. The obtained results showed that the addition of itaconic acid and methyl acrylate as comonomers resulted a lower heat flow during the process comparing to the PAN homopolymer. It suggested that these comonomers aid the oxidative stabilization stage for all studied process. The redox system polymerization at 40°C resulted in a lower heat flow. Itaconic acid decreases slightly initial and peak temperatures of the terpolymer and heat flow until concentration of 3y. The cyclization temperature decreases when MAis incorporated into the terpolymer compared to the MMA terpolymer and increases when MAA is the acidic monomer. Among terpolymers the AN/MA/AA polymer showed the best thermal behavior for carbon fiber producing.     

Bioelectrochemical application of some PQQ-dependent enzymes.

This paper focuses on the use of PQQ-dependent enzymes (PQQ enzymes) in amperometrical biosensors and gives emphasis on their innovative designs and applications. The study covers some aspects in the evolution of biosensors based on PQQ enzymes. Main attention is focused on the electrochemical properties of PQQ enzymes as very promising materials for the formation of electrochemical biosensors. Immobilization approaches and redox mediators recently used in PQQ enzymes based biosensors are reviewed. The acceptance of polypyrrole as a very promising immobilization matrix for some PQQ enzymes is discussed.