Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

Evaluation of cellulase preparations for hydrolysis of hardwood substrates

Seven cellulase preparations from Penicillium and Trichoderma spp. were evaluated for their ability to hydrolyze the cellulose fraction of hardwoods (yellow poplar and red maple) pretreated by organosolv extraction, as well as model cellulosic substrates such as filter paper. There was no significant correlation among hydrolytic performance on pretreated hardwood, based on glucose release, and filter paper activity. However, performance on pretreated hardwood showed significant correlations to the levels of endogenous β-glucosidase and xylanase activities in the cellulase preparation. Accordingly, differences in performance were reduced or eliminated following supplementation with a crude β-glucosidase preparation containing both activities. These results complement a previous investigation using softwoods pretreated by either organosolv extraction or steam explosion. Cellulase preparations that performed best on hardwood also showed superior performance on the softwood substrates.     

Core-shell nanostructures from single poly(N-vinylcaprolactam) macromolecules: stabilization and visualization

Formation of core-shell poly(N-vinylcaprolactam) (PVCL) single-molecule nanostructures due to interaction of PVCL with metal ions was studied using transmission electron microscopy, 13C NMR, and light scattering. This study demonstrates that addition of CoCl2 to PVCL in its globular conformation yields unimolecular core-shell polymer particles with the core decorated with Co(II) ions. The crucial condition for formation of well-defined unimolecular nanostructures is the presence of stable globular aggregates in aqueous solution. Moreover, the metal ions should have a sufficiently high coordination number (higher than 2) to provide a cross-linking and stabilization of the core.     

Geometry changes of a Cu(I) phenanthroline complex on photoexcitation in a confining medium by time-resolved X-ray diffraction

Using a stroboscopic technique, in which the molecule is repeatedly excited and the structural change is probed more than 5000 times per second immediately after excitation, we performed a 16 K time-resolved single-crystal study of the microsecond lifetime triplet state of the Cu(I)phenanthroline derivative[Cu(I)(dmp)(dppe)][PF6] (dppe = 1,2-bis(diphenylphosphino)ethane). The geometry changes on excitation differ for the two symmetry-independent molecules, but are in the same direction as calculated for an isolated reference molecule, although the flattening distortion in the crystal is significantly smaller, implying that the reorganization energy is greatly affected by the confining medium.     

Reactions of Allyl Alcohols of the Pinane Series and of Their Epoxides in the Presence of Montmorillonite Clay

The reactivity of allyl alcohols of the pinane series and of their epoxides in the presence of montmorillonite clay in intra‐ and intermolecular reactions was studied. Mutual transformations of (+)‐trans‐pinocarveol ((+)‐ 2 ) and (?)‐myrtenol ((?)‐ 3a ) were major reactions of these compounds on askanite–bentonite clay (Schemes 1 and 2). However, the two reactions gave different isomerization products, indicating that the reactivity of the starting alcohol (+)‐ 2 or (?)‐ 3a was different from that of the same compound (+)‐ 2 or (?)‐ 3 formed in the course of the reactions. (?)‐cis‐ and (+)‐trans‐Verbenol ((?)‐ 16 and (+)‐ 12 , resp.), as well as (?)‐cis‐verbenol epoxide ((?)‐ 20 ) reacted with both aliphatic and aromatic aldehydes on askanite–bentonite clay giving various heterocyclic compounds (Schemes 4, 5 and 7); the reaction path depended on the structure of both the terpenoid and the aldehyde.     

Visualization and characterization of electroactive defects in the native oxide film on aluminium

Spatial!y localized electrochemical activity at Al/Al2O3 electrodes has been investigated using scanning electrochemical microscopy (SECM) in order to establish the relationship between localized corrosion of Al (and Al alloys) with the defect structure of the native Al2O3 film. Local electron transfer at microscopic defects (2 to 50 microm radius) was visualized in acetonitrile solutions using the nitrobenzene/nitrobenzene radical anion (Eo approximately -1.6 V vs. Ag/Ag+) and tetracyanoquinodimethane/tetracyanoquinodimethane radical anion couples (Eo approximately -0.3 V) as redox mediators for imaging. SECM investigations revealed no significant differences in electrochemical activity at Al/AI203 electrodes in the two mediator solutions, indicating that electrical conduction at the defect sites is weakly dependent on interfacial potential and the electric field across the Al2O3 film. The density of electroactive defects observed by SECM varied by 2 to 3 orders of magnitude between electrodes prepared from the same source of Al (either 99.450% and 99.9995%) suggesting that electrical conduction in the native oxide is very sensitive to surface preparation. Defect densities as low as approximately 3 sites cm(-2) were readily measured by SECM.     

Fluorophore-quencher distance correlation functions from single-molecule photon arrival trajectories

We generalize and simplify the method of Yang and Xie (J. Chem. Phys. 2002, 117, 10965) to obtain distance correlation functions from photon arrival trajectories of single fluorophores whose lifetime, [k(r)](-1), depends on the distance to a quencher. It is assumed that this distance does not change during the fluorescence lifetime. The experimental trajectory is first transformed by replacing the delay time (i.e., the interval between the photon arrival and the nearest laser pulse) by a certain function of this delay time. This function is the inverse Laplace transform of r(k), which is the solution of k(r) = 1. The correlation function of the transformed data then directly gives the distance correlation function. Illustrative examples include F?rster energy transfer and quenching due to electron transfer.     

Synthesis of monodisperse polymers from proteins

Proteins are functional biopolymers; viewed as molecules, they are also monodisperse polyamides with chemically reactive side chains. This paper describes the use of proteins as starting materials for the synthesis of monodisperse polymers with nonbiological functionalities attached to the side chains. It demonstrates the complete derivatization of amine groups (lysine side chains and N-termini) on three different proteins by addition of activated carboxylate reagents in aqueous solutions containing sodium dedecyl sulfate (SDS), under denaturing conditions. Several different acylating reagents were used to generate derivatized proteins; the resulting compounds constitute a new class of monodisperse, semisynthetic polymers, having the potential for wide variation in the structure of the backbone and of the side chains. Modification of lysozyme on a gram scale demonstrated that the method can generate useful quantities of material.     

Ate complexes of Ge(II) and Sn(II) with bidentate ligands [LiE(OCH2CH2NMe2)3]2 (E=Ge, Sn): synthesis and structure

The reaction of equimolar quantities of LiOCH₂CH₂NMe₂ and E¹⁴(OCH₂CH₂NMe₂)₂ (E¹⁴=Ge, Sn) in ether yielded new ate complexes [LiE¹⁴(OCH₂CH₂NMe₂)₃]₂ (E¹⁴=Ge (1), Sn (2)) with bidentate ligands. The compounds 1 and 2 are white crystalline substances which are highly soluble in THF and pyridine and very sensitive to the traces of oxygen and moisture. The structures of these compounds are studied by X-ray diffraction analysis. The ate complexes 1 and 2 are powerful nucleophiles and may be employed as ligands (neutral) in the coordination chemistry of the transition metals. The electronegative O-substituents at the divalent E¹⁴ atoms render them less oxidizable than alkyl- or aryl-substituted derivatives, and the bidentate ligands, owing to intramolecular donor-acceptor interactions, make them more thermodynamically stable compared to monodentate ligands.     

Evidence for specific solvation of two halocarbene amides

Laser flash photolysis (LFP, 308 nm) of endo-10-halo-10'-N,N-dimethylcarboxamidetricyclo[4.3.1.0]-deca-2,4-diene (1Cl and 1F) releases indan and halocarbene amide (2Cl and 2F). Although the carbenes are not UV-vis active, they react rapidly with pyridine to form ylides (4Cl, 4F), which are readily detected in LFP experiments (lambda(max) = 450 nm). Dioxane decreases the observed rate of carbene reaction with pyridine in CF(2)ClCFCl(2). Small amounts of THF decrease the observed rate of reaction of carbene 2F with pyridine but increase the rate of reaction of carbene 2Cl with pyridine. LFP (266 nm) of dienes 1Cl and 1F in CF(2)ClCFCl(2) with IR detection produces carbenes 2Cl and 2F with carbonyl vibrations at 1635 and 1650 cm(-1), respectively. In dioxane or THF solvent, LFP produces the corresponding ether ylides (5Cl, 5F) by capture of carbenes 2Cl and 2F. The ylides have broad carbonyl vibrations between 1560 and 1610 cm(-1). The addition of a small amount of dioxane in CFCl(2)CF(2)Cl extends the lifetime of the carbene. This observation, together with the ether-induced retardation of the rates of carbene capture by tetramethylethylene and pyridine, is evidence for solvation of the carbene by dioxane.