Synthesis and immobilization of quaternary ammonium cations in acidic zeolites

A general method for the synthesis of quaternary ammonium cations in acidic zeolites by a direct reaction of tertiary amines and alcohols is described.     

Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

Platinum nanoparticles generated in functionality-enhanced reaction media based on polyoctadecylsiloxane with long-chain functional modifiers

Functionality-enhanced nanostructured matrices generated by intercalating polyoctadecylsiloxane (PODS) with octadecene (ODC) or octadecylamine (ODA) are employed as reaction media in which to grow Pt nanoparticles. Small-angle X-ray scattering (SAXS) signatures confirm that the amphiphilic PODS matrix orders into lamellae with a periodicity (d) of 5.24 nm, which corresponds to the siloxy bilayer and a double layer of alkyl tails. The regular packing of the hydrophobic tails becomes distorted upon introduction of ODC or ODA. Incorporation of K[(C2H4)PtCl3].H2O (a Zeise salt) into the PODS/ODC matrix, followed by reduction of the Pt ions by NaBH4 or H2, results in the localization of Pt compounds and nanoparticles along the siloxy bilayers, which remain dimensionally unchanged. Electron density profiles deduced from PODS/ODA, however, provide evidence for considerable structural reorganization upon metalation with H2PtCl6.6H2O. In this case, the siloxy bilayers broaden due to the presence of PtCl62- ions, and the hydrophobic layers become distorted due to the formation of (PtCl62-)(ODAH+)2 complexes. Subsequent reduction by NaBH4 restores the inherent PODS organization, while H2 reduction partially preserves the distorted matrix, indicating that some Pt nanoparticles form in close proximity to the siloxy bilayer. Transmission electron microscopy reveals that relatively monodisperse Pt nanoparticles measuring approximately 1 nm in diameter are located along the siloxy bilayers, whereas anomalous SAXS further indicates that nanoparticles form aggregates of comparable size to d within the PODS double layers.     

Evaluation of cellulase preparations for hydrolysis of hardwood substrates

Seven cellulase preparations from Penicillium and Trichoderma spp. were evaluated for their ability to hydrolyze the cellulose fraction of hardwoods (yellow poplar and red maple) pretreated by organosolv extraction, as well as model cellulosic substrates such as filter paper. There was no significant correlation among hydrolytic performance on pretreated hardwood, based on glucose release, and filter paper activity. However, performance on pretreated hardwood showed significant correlations to the levels of endogenous β-glucosidase and xylanase activities in the cellulase preparation. Accordingly, differences in performance were reduced or eliminated following supplementation with a crude β-glucosidase preparation containing both activities. These results complement a previous investigation using softwoods pretreated by either organosolv extraction or steam explosion. Cellulase preparations that performed best on hardwood also showed superior performance on the softwood substrates.     

Core-shell nanostructures from single poly(N-vinylcaprolactam) macromolecules: stabilization and visualization

Formation of core-shell poly(N-vinylcaprolactam) (PVCL) single-molecule nanostructures due to interaction of PVCL with metal ions was studied using transmission electron microscopy, 13C NMR, and light scattering. This study demonstrates that addition of CoCl2 to PVCL in its globular conformation yields unimolecular core-shell polymer particles with the core decorated with Co(II) ions. The crucial condition for formation of well-defined unimolecular nanostructures is the presence of stable globular aggregates in aqueous solution. Moreover, the metal ions should have a sufficiently high coordination number (higher than 2) to provide a cross-linking and stabilization of the core.     

Novel laccase redox mediators: spectral, electrochemical, and kinetic properties

The screening of potential redox mediators for laccase was performed using homogeneous enzyme preparations from Coriolus hirsutus and Coriolus zonatus. It was discovered that derivatives of 1-phenyl-3-methyl-pyrazolones were efficient substrates for the laccases. The characterization of two representatives of the 1-phenyl-pyrazolone class, sodium 1-phenyl-3-methyl-4- methylamino-pyrazolone-5-N(4)-methanesulfonate and 1-(3'-sulfophenyl)-3- methylpyrazolone-5, in the reaction catalyzed by laccase was carried out using spectral, electrochemical, and enzyme kinetics methods. The kinetic parameters for the oxidation of the newly discovered substrates were comparable with those for 2,2'-azino-bis(3-ethylbenzthiazoline-6-sulfonate) (ABTS) oxidation by laccase. Electrochemical experiments demonstrated that oxidation of these compounds yielded two high-potential intermediates capable of oxidizing veratryl alcohol, which was used as a lignin model substrate, to the corresponding aldehyde and acid. 1-(3'-Sulfophenyl)-3- methylpyrazolone-5 was about 30-40% as effective in degrading veratryl alcohol compared to ABTS as judged from high-performance liquid chromatography kinetic studies. 1-Phenyl-3-methyl-pyrazolones may be of commercial interest for oxidoreductase-catalyzed biodegradation of organic compounds.     

Reactions of 4,7‐dihydro‐1,2,4‐triazolo[1,5‐a]pyrimidines with α,β‐unsaturated carbonyl compounds

The reaction of 5,7‐diphenyl‐4,7‐dihydro‐1,2,4‐triazolo[1,5‐a]pyrimidine ( 1 ) with α,β‐unsaturated carbonyl compounds 2a‐f led to the formation of the alkylated heterocycles 3a‐f (Figure 1). However, the reaction of 5‐methyl‐7‐phenyl‐4,7‐dihydro‐1,2,4‐triazolo[1,5‐a]pyrimidine ( 5 ) with 2a‐c yielded under the same conditions the triazolo[5,1‐b]quinazolines 6a‐c (Figure 3). In this case, the alkylation is followed by a cyclocondensation. The structure elucidation of the products is based on ir, ms, ¹H and ¹³C nmr measurements and on an X‐ray diffraction study.     

Thermal behavior of polyacrylonitrile polymers synthesized under different conditions and comonomer compositions

Polyacrylonitrile (PAN) polymers are used as precursors for carbon fiber production. This process requires an oxidative stabilization step, which can be studied by differential scanning calorimetry (DSC). In this sense, thermal behavior of PAN based terpolymers by different polymerization processes, compositions and itaconic acid concentrations in the reaction media were investigated. The obtained results showed that the addition of itaconic acid and methyl acrylate as comonomers resulted a lower heat flow during the process comparing to the PAN homopolymer. It suggested that these comonomers aid the oxidative stabilization stage for all studied process. The redox system polymerization at 40°C resulted in a lower heat flow. Itaconic acid decreases slightly initial and peak temperatures of the terpolymer and heat flow until concentration of 3y. The cyclization temperature decreases when MAis incorporated into the terpolymer compared to the MMA terpolymer and increases when MAA is the acidic monomer. Among terpolymers the AN/MA/AA polymer showed the best thermal behavior for carbon fiber producing.     

Bioelectrochemical application of some PQQ-dependent enzymes.

This paper focuses on the use of PQQ-dependent enzymes (PQQ enzymes) in amperometrical biosensors and gives emphasis on their innovative designs and applications. The study covers some aspects in the evolution of biosensors based on PQQ enzymes. Main attention is focused on the electrochemical properties of PQQ enzymes as very promising materials for the formation of electrochemical biosensors. Immobilization approaches and redox mediators recently used in PQQ enzymes based biosensors are reviewed. The acceptance of polypyrrole as a very promising immobilization matrix for some PQQ enzymes is discussed.     

Geometry changes of a Cu(I) phenanthroline complex on photoexcitation in a confining medium by time-resolved X-ray diffraction

Using a stroboscopic technique, in which the molecule is repeatedly excited and the structural change is probed more than 5000 times per second immediately after excitation, we performed a 16 K time-resolved single-crystal study of the microsecond lifetime triplet state of the Cu(I)phenanthroline derivative[Cu(I)(dmp)(dppe)][PF6] (dppe = 1,2-bis(diphenylphosphino)ethane). The geometry changes on excitation differ for the two symmetry-independent molecules, but are in the same direction as calculated for an isolated reference molecule, although the flattening distortion in the crystal is significantly smaller, implying that the reorganization energy is greatly affected by the confining medium.